\
| Variant ID: vg0811929425 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 11929425 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 42. )
ATCGGCACTTAGCCGATCGGCTATCGTTTATGGATTCAACCGCAGTTTCTTTGTCTTTGTTCTTGTTGATTGCAGGATCAAATCAACTGGCACGCTAGCA[C/T]
ACCCGAAGGTGAGTTTTGGACCTACACTGGAGTTAAGCAGATCTCCCAGGCCTTGTGTTTTCACATCAACACGCTTTTGGCACGCCCGGTGGGACCGATC
GATCGGTCCCACCGGGCGTGCCAAAAGCGTGTTGATGTGAAAACACAAGGCCTGGGAGATCTGCTTAACTCCAGTGTAGGTCCAAAACTCACCTTCGGGT[G/A]
TGCTAGCGTGCCAGTTGATTTGATCCTGCAATCAACAAGAACAAAGACAAAGAAACTGCGGTTGAATCCATAAACGATAGCCGATCGGCTAAGTGCCGAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 27.40% | 7.60% | 9.67% | 55.27% | NA |
| All Indica | 2759 | 11.90% | 12.60% | 14.10% | 61.33% | NA |
| All Japonica | 1512 | 61.40% | 0.30% | 2.18% | 36.04% | NA |
| Aus | 269 | 1.10% | 0.70% | 6.69% | 91.45% | NA |
| Indica I | 595 | 3.90% | 9.40% | 11.60% | 75.13% | NA |
| Indica II | 465 | 10.50% | 10.50% | 12.04% | 66.88% | NA |
| Indica III | 913 | 18.00% | 17.60% | 13.91% | 50.49% | NA |
| Indica Intermediate | 786 | 11.80% | 10.60% | 17.43% | 60.18% | NA |
| Temperate Japonica | 767 | 85.40% | 0.40% | 2.61% | 11.60% | NA |
| Tropical Japonica | 504 | 36.50% | 0.20% | 1.98% | 61.31% | NA |
| Japonica Intermediate | 241 | 37.30% | 0.40% | 1.24% | 61.00% | NA |
| VI/Aromatic | 96 | 7.30% | 0.00% | 5.21% | 87.50% | NA |
| Intermediate | 90 | 31.10% | 5.60% | 13.33% | 50.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0811929425 | C -> T | LOC_Os08g19920.1 | missense_variant ; p.His75Tyr; MODERATE | nonsynonymous_codon ; H75Y | Average:17.1; most accessible tissue: Callus, score: 41.048 | unknown | unknown | TOLERATED | 1.00 |
| vg0811929425 | C -> DEL | LOC_Os08g19920.1 | N | frameshift_variant | Average:17.1; most accessible tissue: Callus, score: 41.048 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0811929425 | NA | 3.62E-06 | mr1044 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811929425 | NA | 3.84E-06 | mr1049 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811929425 | NA | 5.13E-08 | mr1238 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811929425 | NA | 1.88E-07 | mr1309 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811929425 | NA | 6.12E-06 | mr1318 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811929425 | NA | 1.33E-06 | mr1704 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811929425 | 8.61E-08 | 5.95E-11 | mr1708 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811929425 | NA | 3.91E-07 | mr1708 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811929425 | NA | 8.11E-06 | mr1794 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811929425 | NA | 4.77E-07 | mr1803 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811929425 | NA | 3.47E-08 | mr1841 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811929425 | NA | 1.90E-09 | mr1864 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811929425 | 2.83E-08 | 2.83E-08 | mr1900 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811929425 | NA | 3.91E-06 | mr1011_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811929425 | NA | 7.71E-06 | mr1170_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811929425 | NA | 1.82E-06 | mr1509_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811929425 | NA | 8.56E-06 | mr1900_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |