\
| Variant ID: vg0811905123 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 11905123 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CACTGAACCTTAATACTTCATATATAGGACCTGTGATAGCAAGAATATTCTCAACATTATTCCAAAAGTCCTCACAATTGATTTCTTGAACAATGGCTCT[T/A]
GCTTGCTGCCGCAGATCATTGGTGCAACCTTTCATCCAATCTTTCCATTGATTGGTGACTATGGTGGTGGCAAGTGCTTCTTGACATTTAGTGAGCCTCA
TGAGGCTCACTAAATGTCAAGAAGCACTTGCCACCACCATAGTCACCAATCAATGGAAAGATTGGATGAAAGGTTGCACCAATGATCTGCGGCAGCAAGC[A/T]
AGAGCCATTGTTCAAGAAATCAATTGTGAGGACTTTTGGAATAATGTTGAGAATATTCTTGCTATCACAGGTCCTATATATGAAGTATTAAGGTTCAGTG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 49.70% | 39.80% | 1.74% | 8.84% | NA |
| All Indica | 2759 | 81.20% | 6.70% | 2.75% | 9.39% | NA |
| All Japonica | 1512 | 2.20% | 88.10% | 0.00% | 9.72% | NA |
| Aus | 269 | 15.60% | 83.30% | 0.74% | 0.37% | NA |
| Indica I | 595 | 94.50% | 0.30% | 2.86% | 2.35% | NA |
| Indica II | 465 | 85.80% | 7.50% | 1.51% | 5.16% | NA |
| Indica III | 913 | 72.90% | 6.40% | 3.83% | 16.87% | NA |
| Indica Intermediate | 786 | 78.00% | 11.30% | 2.16% | 8.52% | NA |
| Temperate Japonica | 767 | 2.00% | 97.80% | 0.00% | 0.26% | NA |
| Tropical Japonica | 504 | 1.60% | 72.60% | 0.00% | 25.79% | NA |
| Japonica Intermediate | 241 | 4.10% | 89.60% | 0.00% | 6.22% | NA |
| VI/Aromatic | 96 | 2.10% | 90.60% | 0.00% | 7.29% | NA |
| Intermediate | 90 | 33.30% | 57.80% | 4.44% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0811905123 | T -> A | LOC_Os08g19870.1 | synonymous_variant ; p.Ala411Ala; LOW | synonymous_codon | Average:50.869; most accessible tissue: Zhenshan97 flag leaf, score: 68.703 | N | N | N | N |
| vg0811905123 | T -> A | LOC_Os08g19870.1 | synonymous_variant ; p.Ala411Ala; LOW | nonsynonymous_codon ; A411V | Average:50.869; most accessible tissue: Zhenshan97 flag leaf, score: 68.703 | unknown | unknown | DELETERIOUS | 0.02 |
| vg0811905123 | T -> DEL | LOC_Os08g19870.1 | N | frameshift_variant | Average:50.869; most accessible tissue: Zhenshan97 flag leaf, score: 68.703 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0811905123 | NA | 4.21E-09 | mr1134 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811905123 | 8.68E-06 | NA | mr1135 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811905123 | NA | 1.14E-08 | mr1135 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811905123 | NA | 1.09E-22 | mr1422 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811905123 | NA | 9.64E-10 | mr1504 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811905123 | NA | 1.67E-18 | mr1583 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811905123 | NA | 6.76E-06 | mr1672 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811905123 | NA | 6.65E-15 | mr1870 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811905123 | NA | 5.47E-07 | mr1134_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811905123 | NA | 5.01E-10 | mr1134_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811905123 | NA | 1.45E-07 | mr1215_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811905123 | NA | 2.21E-19 | mr1218_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811905123 | NA | 6.71E-27 | mr1422_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811905123 | NA | 1.65E-14 | mr1583_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811905123 | NA | 7.65E-07 | mr1672_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811905123 | NA | 6.86E-14 | mr1850_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |