\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0811898736:

Variant ID: vg0811898736 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 11898736
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTCGTCTCGCAATTTACATGTAAACTGTGCAATTAGTTTTTTTCGTTCACATTTAATGCTTCATACATATGTACAAATATTTGATGTGACGGAATTTTTG[A/G]
AAGTTTGAAGGGGACTAAACACAACCAAAGATATATTTTCTCTTTGTAAATAATATCCCTATGATATCAGTACGTTGTTTAAAGTATAAACATAATCCCC

Reverse complement sequence

GGGGATTATGTTTATACTTTAAACAACGTACTGATATCATAGGGATATTATTTACAAAGAGAAAATATATCTTTGGTTGTGTTTAGTCCCCTTCAAACTT[T/C]
CAAAAATTCCGTCACATCAAATATTTGTACATATGTATGAAGCATTAAATGTGAACGAAAAAAACTAATTGCACAGTTTACATGTAAATTGCGAGACGAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.70% 20.20% 0.06% 0.00% NA
All Indica  2759 99.50% 0.50% 0.00% 0.00% NA
All Japonica  1512 39.60% 60.30% 0.13% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 99.30% 0.70% 0.00% 0.00% NA
Indica Intermediate  786 99.10% 0.90% 0.00% 0.00% NA
Temperate Japonica  767 15.40% 84.60% 0.00% 0.00% NA
Tropical Japonica  504 64.50% 35.10% 0.40% 0.00% NA
Japonica Intermediate  241 64.30% 35.70% 0.00% 0.00% NA
VI/Aromatic  96 92.70% 7.30% 0.00% 0.00% NA
Intermediate  90 74.40% 24.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0811898736 A -> G LOC_Os08g19850.1 upstream_gene_variant ; 1243.0bp to feature; MODIFIER silent_mutation Average:67.646; most accessible tissue: Zhenshan97 root, score: 81.772 N N N N
vg0811898736 A -> G LOC_Os08g19860.1 upstream_gene_variant ; 2487.0bp to feature; MODIFIER silent_mutation Average:67.646; most accessible tissue: Zhenshan97 root, score: 81.772 N N N N
vg0811898736 A -> G LOC_Os08g19850-LOC_Os08g19860 intergenic_region ; MODIFIER silent_mutation Average:67.646; most accessible tissue: Zhenshan97 root, score: 81.772 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0811898736 4.18E-06 7.50E-09 mr1238 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811898736 NA 4.54E-07 mr1309 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811898736 NA 1.78E-10 mr1471 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811898736 NA 1.34E-07 mr1587 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811898736 NA 4.72E-06 mr1704 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811898736 1.67E-07 4.79E-11 mr1708 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811898736 NA 7.55E-07 mr1708 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811898736 NA 2.02E-08 mr1803 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811898736 3.83E-06 1.09E-09 mr1841 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811898736 NA 8.86E-06 mr1851 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811898736 NA 8.95E-10 mr1864 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811898736 1.53E-07 1.53E-07 mr1900 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811898736 NA 4.07E-06 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811898736 NA 5.23E-08 mr1238_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811898736 NA 1.23E-06 mr1484_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811898736 NA 2.41E-06 mr1509_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811898736 NA 1.63E-08 mr1841_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811898736 NA 3.67E-07 mr1900_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251