Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0811898736:

Variant ID: vg0811898736 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 11898736
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTCGTCTCGCAATTTACATGTAAACTGTGCAATTAGTTTTTTTCGTTCACATTTAATGCTTCATACATATGTACAAATATTTGATGTGACGGAATTTTTG[A/G]
AAGTTTGAAGGGGACTAAACACAACCAAAGATATATTTTCTCTTTGTAAATAATATCCCTATGATATCAGTACGTTGTTTAAAGTATAAACATAATCCCC

Reverse complement sequence

GGGGATTATGTTTATACTTTAAACAACGTACTGATATCATAGGGATATTATTTACAAAGAGAAAATATATCTTTGGTTGTGTTTAGTCCCCTTCAAACTT[T/C]
CAAAAATTCCGTCACATCAAATATTTGTACATATGTATGAAGCATTAAATGTGAACGAAAAAAACTAATTGCACAGTTTACATGTAAATTGCGAGACGAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	79.70%	20.20%	0.06%	0.00%	NA
All Indica	2759	99.50%	0.50%	0.00%	0.00%	NA
All Japonica	1512	39.60%	60.30%	0.13%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.60%	0.40%	0.00%	0.00%	NA
Indica III	913	99.30%	0.70%	0.00%	0.00%	NA
Indica Intermediate	786	99.10%	0.90%	0.00%	0.00%	NA
Temperate Japonica	767	15.40%	84.60%	0.00%	0.00%	NA
Tropical Japonica	504	64.50%	35.10%	0.40%	0.00%	NA
Japonica Intermediate	241	64.30%	35.70%	0.00%	0.00%	NA
VI/Aromatic	96	92.70%	7.30%	0.00%	0.00%	NA
Intermediate	90	74.40%	24.40%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0811898736	A -> G	LOC_Os08g19850.1	upstream_gene_variant ; 1243.0bp to feature; MODIFIER	silent_mutation	Average:67.646; most accessible tissue: Zhenshan97 root, score: 81.772	N	N	N	N
vg0811898736	A -> G	LOC_Os08g19860.1	upstream_gene_variant ; 2487.0bp to feature; MODIFIER	silent_mutation	Average:67.646; most accessible tissue: Zhenshan97 root, score: 81.772	N	N	N	N
vg0811898736	A -> G	LOC_Os08g19850-LOC_Os08g19860	intergenic_region ; MODIFIER	silent_mutation	Average:67.646; most accessible tissue: Zhenshan97 root, score: 81.772	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0811898736	4.18E-06	7.50E-09	mr1238	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811898736	NA	4.54E-07	mr1309	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811898736	NA	1.78E-10	mr1471	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811898736	NA	1.34E-07	mr1587	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811898736	NA	4.72E-06	mr1704	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811898736	1.67E-07	4.79E-11	mr1708	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811898736	NA	7.55E-07	mr1708	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811898736	NA	2.02E-08	mr1803	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811898736	3.83E-06	1.09E-09	mr1841	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811898736	NA	8.86E-06	mr1851	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811898736	NA	8.95E-10	mr1864	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811898736	1.53E-07	1.53E-07	mr1900	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811898736	NA	4.07E-06	mr1011_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811898736	NA	5.23E-08	mr1238_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811898736	NA	1.23E-06	mr1484_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811898736	NA	2.41E-06	mr1509_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811898736	NA	1.63E-08	mr1841_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811898736	NA	3.67E-07	mr1900_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251