Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0811700880:

Variant ID: vg0811700880 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 11700880
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 65. )

Flanking Sequence (100 bp) in Reference Genome:

GTATATTAAATTGTCAGTTTGTGTACCTCGGCTGATTCCTGGACGAGGATTTTATGCACAAATAAGTTCGGAAATTACTAGTGAATTTCCGGACGTGACA[A/G]
GTTTTCTTTGCAACTGCTTGAATGAAAAGACGACGATATCGATGGATATTAGATCCAACGCTTGGCATAAGAATCCATGCGACGCGGTAAGGTCCCAAAG

Reverse complement sequence

CTTTGGGACCTTACCGCGTCGCATGGATTCTTATGCCAAGCGTTGGATCTAATATCCATCGATATCGTCGTCTTTTCATTCAAGCAGTTGCAAAGAAAAC[T/C]
TGTCACGTCCGGAAATTCACTAGTAATTTCCGAACTTATTTGTGCATAAAATCCTCGTCCAGGAATCAGCCGAGGTACACAAACTGACAATTTAATATAC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	14.30%	4.40%	15.79%	65.53%	NA
All Indica	2759	2.40%	0.00%	18.16%	79.38%	NA
All Japonica	1512	39.10%	13.10%	7.08%	40.74%	NA
Aus	269	1.50%	0.00%	42.38%	56.13%	NA
Indica I	595	1.00%	0.00%	6.89%	92.10%	NA
Indica II	465	2.60%	0.00%	11.83%	85.59%	NA
Indica III	913	3.40%	0.00%	30.01%	66.59%	NA
Indica Intermediate	786	2.30%	0.10%	16.67%	80.92%	NA
Temperate Japonica	767	59.50%	23.70%	3.26%	13.56%	NA
Tropical Japonica	504	15.10%	0.40%	13.69%	70.83%	NA
Japonica Intermediate	241	24.50%	5.80%	5.39%	64.32%	NA
VI/Aromatic	96	5.20%	0.00%	6.25%	88.54%	NA
Intermediate	90	11.10%	7.80%	20.00%	61.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0811700880	A -> G	LOC_Os08g19590.1	upstream_gene_variant ; 1723.0bp to feature; MODIFIER	silent_mutation	Average:75.588; most accessible tissue: Zhenshan97 flag leaf, score: 85.13	N	N	N	N
vg0811700880	A -> G	LOC_Os08g19590.3	upstream_gene_variant ; 1723.0bp to feature; MODIFIER	silent_mutation	Average:75.588; most accessible tissue: Zhenshan97 flag leaf, score: 85.13	N	N	N	N
vg0811700880	A -> G	LOC_Os08g19590.2	upstream_gene_variant ; 3510.0bp to feature; MODIFIER	silent_mutation	Average:75.588; most accessible tissue: Zhenshan97 flag leaf, score: 85.13	N	N	N	N
vg0811700880	A -> G	LOC_Os08g19570.1	downstream_gene_variant ; 3543.0bp to feature; MODIFIER	silent_mutation	Average:75.588; most accessible tissue: Zhenshan97 flag leaf, score: 85.13	N	N	N	N
vg0811700880	A -> G	LOC_Os08g19570-LOC_Os08g19590	intergenic_region ; MODIFIER	silent_mutation	Average:75.588; most accessible tissue: Zhenshan97 flag leaf, score: 85.13	N	N	N	N
vg0811700880	A -> DEL	N	N	silent_mutation	Average:75.588; most accessible tissue: Zhenshan97 flag leaf, score: 85.13	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0811700880	NA	7.24E-06	mr1708	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811700880	NA	4.29E-06	mr1255_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811700880	NA	1.10E-06	mr1404_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811700880	1.93E-06	3.38E-10	mr1693_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811700880	NA	8.91E-07	mr1693_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811700880	NA	3.57E-09	mr1741_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811700880	NA	3.56E-08	mr1746_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251