\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0811700880:

Variant ID: vg0811700880 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 11700880
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 65. )

Flanking Sequence (100 bp) in Reference Genome:


GTATATTAAATTGTCAGTTTGTGTACCTCGGCTGATTCCTGGACGAGGATTTTATGCACAAATAAGTTCGGAAATTACTAGTGAATTTCCGGACGTGACA[A/G]
GTTTTCTTTGCAACTGCTTGAATGAAAAGACGACGATATCGATGGATATTAGATCCAACGCTTGGCATAAGAATCCATGCGACGCGGTAAGGTCCCAAAG

Reverse complement sequence

CTTTGGGACCTTACCGCGTCGCATGGATTCTTATGCCAAGCGTTGGATCTAATATCCATCGATATCGTCGTCTTTTCATTCAAGCAGTTGCAAAGAAAAC[T/C]
TGTCACGTCCGGAAATTCACTAGTAATTTCCGAACTTATTTGTGCATAAAATCCTCGTCCAGGAATCAGCCGAGGTACACAAACTGACAATTTAATATAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 14.30% 4.40% 15.79% 65.53% NA
All Indica  2759 2.40% 0.00% 18.16% 79.38% NA
All Japonica  1512 39.10% 13.10% 7.08% 40.74% NA
Aus  269 1.50% 0.00% 42.38% 56.13% NA
Indica I  595 1.00% 0.00% 6.89% 92.10% NA
Indica II  465 2.60% 0.00% 11.83% 85.59% NA
Indica III  913 3.40% 0.00% 30.01% 66.59% NA
Indica Intermediate  786 2.30% 0.10% 16.67% 80.92% NA
Temperate Japonica  767 59.50% 23.70% 3.26% 13.56% NA
Tropical Japonica  504 15.10% 0.40% 13.69% 70.83% NA
Japonica Intermediate  241 24.50% 5.80% 5.39% 64.32% NA
VI/Aromatic  96 5.20% 0.00% 6.25% 88.54% NA
Intermediate  90 11.10% 7.80% 20.00% 61.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0811700880 A -> G LOC_Os08g19590.1 upstream_gene_variant ; 1723.0bp to feature; MODIFIER silent_mutation Average:75.588; most accessible tissue: Zhenshan97 flag leaf, score: 85.13 N N N N
vg0811700880 A -> G LOC_Os08g19590.3 upstream_gene_variant ; 1723.0bp to feature; MODIFIER silent_mutation Average:75.588; most accessible tissue: Zhenshan97 flag leaf, score: 85.13 N N N N
vg0811700880 A -> G LOC_Os08g19590.2 upstream_gene_variant ; 3510.0bp to feature; MODIFIER silent_mutation Average:75.588; most accessible tissue: Zhenshan97 flag leaf, score: 85.13 N N N N
vg0811700880 A -> G LOC_Os08g19570.1 downstream_gene_variant ; 3543.0bp to feature; MODIFIER silent_mutation Average:75.588; most accessible tissue: Zhenshan97 flag leaf, score: 85.13 N N N N
vg0811700880 A -> G LOC_Os08g19570-LOC_Os08g19590 intergenic_region ; MODIFIER silent_mutation Average:75.588; most accessible tissue: Zhenshan97 flag leaf, score: 85.13 N N N N
vg0811700880 A -> DEL N N silent_mutation Average:75.588; most accessible tissue: Zhenshan97 flag leaf, score: 85.13 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0811700880 NA 7.24E-06 mr1708 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811700880 NA 4.29E-06 mr1255_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811700880 NA 1.10E-06 mr1404_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811700880 1.93E-06 3.38E-10 mr1693_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811700880 NA 8.91E-07 mr1693_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811700880 NA 3.57E-09 mr1741_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811700880 NA 3.56E-08 mr1746_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251