\
| Variant ID: vg0811700880 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 11700880 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 65. )
GTATATTAAATTGTCAGTTTGTGTACCTCGGCTGATTCCTGGACGAGGATTTTATGCACAAATAAGTTCGGAAATTACTAGTGAATTTCCGGACGTGACA[A/G]
GTTTTCTTTGCAACTGCTTGAATGAAAAGACGACGATATCGATGGATATTAGATCCAACGCTTGGCATAAGAATCCATGCGACGCGGTAAGGTCCCAAAG
CTTTGGGACCTTACCGCGTCGCATGGATTCTTATGCCAAGCGTTGGATCTAATATCCATCGATATCGTCGTCTTTTCATTCAAGCAGTTGCAAAGAAAAC[T/C]
TGTCACGTCCGGAAATTCACTAGTAATTTCCGAACTTATTTGTGCATAAAATCCTCGTCCAGGAATCAGCCGAGGTACACAAACTGACAATTTAATATAC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 14.30% | 4.40% | 15.79% | 65.53% | NA |
| All Indica | 2759 | 2.40% | 0.00% | 18.16% | 79.38% | NA |
| All Japonica | 1512 | 39.10% | 13.10% | 7.08% | 40.74% | NA |
| Aus | 269 | 1.50% | 0.00% | 42.38% | 56.13% | NA |
| Indica I | 595 | 1.00% | 0.00% | 6.89% | 92.10% | NA |
| Indica II | 465 | 2.60% | 0.00% | 11.83% | 85.59% | NA |
| Indica III | 913 | 3.40% | 0.00% | 30.01% | 66.59% | NA |
| Indica Intermediate | 786 | 2.30% | 0.10% | 16.67% | 80.92% | NA |
| Temperate Japonica | 767 | 59.50% | 23.70% | 3.26% | 13.56% | NA |
| Tropical Japonica | 504 | 15.10% | 0.40% | 13.69% | 70.83% | NA |
| Japonica Intermediate | 241 | 24.50% | 5.80% | 5.39% | 64.32% | NA |
| VI/Aromatic | 96 | 5.20% | 0.00% | 6.25% | 88.54% | NA |
| Intermediate | 90 | 11.10% | 7.80% | 20.00% | 61.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0811700880 | A -> G | LOC_Os08g19590.1 | upstream_gene_variant ; 1723.0bp to feature; MODIFIER | silent_mutation | Average:75.588; most accessible tissue: Zhenshan97 flag leaf, score: 85.13 | N | N | N | N |
| vg0811700880 | A -> G | LOC_Os08g19590.3 | upstream_gene_variant ; 1723.0bp to feature; MODIFIER | silent_mutation | Average:75.588; most accessible tissue: Zhenshan97 flag leaf, score: 85.13 | N | N | N | N |
| vg0811700880 | A -> G | LOC_Os08g19590.2 | upstream_gene_variant ; 3510.0bp to feature; MODIFIER | silent_mutation | Average:75.588; most accessible tissue: Zhenshan97 flag leaf, score: 85.13 | N | N | N | N |
| vg0811700880 | A -> G | LOC_Os08g19570.1 | downstream_gene_variant ; 3543.0bp to feature; MODIFIER | silent_mutation | Average:75.588; most accessible tissue: Zhenshan97 flag leaf, score: 85.13 | N | N | N | N |
| vg0811700880 | A -> G | LOC_Os08g19570-LOC_Os08g19590 | intergenic_region ; MODIFIER | silent_mutation | Average:75.588; most accessible tissue: Zhenshan97 flag leaf, score: 85.13 | N | N | N | N |
| vg0811700880 | A -> DEL | N | N | silent_mutation | Average:75.588; most accessible tissue: Zhenshan97 flag leaf, score: 85.13 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0811700880 | NA | 7.24E-06 | mr1708 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811700880 | NA | 4.29E-06 | mr1255_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811700880 | NA | 1.10E-06 | mr1404_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811700880 | 1.93E-06 | 3.38E-10 | mr1693_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811700880 | NA | 8.91E-07 | mr1693_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811700880 | NA | 3.57E-09 | mr1741_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811700880 | NA | 3.56E-08 | mr1746_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |