\
| Variant ID: vg0811517885 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 11517885 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.73, T: 0.26, others allele: 0.00, population size: 259. )
GTGCCAACACCATGAACAGAAGCATGTGACCCATTCCCCATTAGGACGGTGGAACCCCGTGCGACCTGATAAGAAGAAAACAATGAGATGTCAACACAAA[C/T]
ATGTACATTGGCCCCTGTATCAACCCACCAATTAGTAGACTGATTAACTGAAAAAATAGTAGGTAAATTACCATACCCGCTTCCATCTCCAGTGTTGCCA
TGGCAACACTGGAGATGGAAGCGGGTATGGTAATTTACCTACTATTTTTTCAGTTAATCAGTCTACTAATTGGTGGGTTGATACAGGGGCCAATGTACAT[G/A]
TTTGTGTTGACATCTCATTGTTTTCTTCTTATCAGGTCGCACGGGGTTCCACCGTCCTAATGGGGAATGGGTCACATGCTTCTGTTCATGGTGTTGGCAC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.60% | 35.10% | 0.25% | 0.00% | NA |
| All Indica | 2759 | 89.60% | 10.00% | 0.33% | 0.00% | NA |
| All Japonica | 1512 | 16.80% | 83.10% | 0.07% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.30% | 2.50% | 0.17% | 0.00% | NA |
| Indica II | 465 | 91.40% | 8.40% | 0.22% | 0.00% | NA |
| Indica III | 913 | 83.40% | 16.20% | 0.44% | 0.00% | NA |
| Indica Intermediate | 786 | 90.10% | 9.50% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 5.30% | 94.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 33.10% | 66.70% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 19.10% | 80.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 12.50% | 87.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 52.20% | 45.60% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0811517885 | C -> T | LOC_Os08g19260.1 | downstream_gene_variant ; 1910.0bp to feature; MODIFIER | silent_mutation | Average:39.619; most accessible tissue: Minghui63 flag leaf, score: 63.692 | N | N | N | N |
| vg0811517885 | C -> T | LOC_Os08g19250.1 | intron_variant ; MODIFIER | silent_mutation | Average:39.619; most accessible tissue: Minghui63 flag leaf, score: 63.692 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0811517885 | NA | 8.73E-08 | mr1134 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811517885 | NA | 1.72E-06 | mr1135 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811517885 | NA | 1.31E-07 | mr1238 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811517885 | NA | 3.38E-06 | mr1309 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811517885 | NA | 4.65E-08 | mr1504 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811517885 | NA | 5.51E-08 | mr1672 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811517885 | NA | 1.12E-08 | mr1841 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811517885 | 9.16E-07 | 9.15E-07 | mr1900 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811517885 | NA | 2.15E-12 | mr1595_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811517885 | NA | 1.87E-08 | mr1600_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811517885 | NA | 1.88E-06 | mr1672_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811517885 | NA | 1.49E-06 | mr1841_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811517885 | NA | 9.95E-06 | mr1900_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |