\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0811513583:

Variant ID: vg0811513583 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 11513583
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTAAGCAGTAAAACATGAACAGATCAAATATGCGCAACATGTCGAACACGTACCGAGGTGGCGGAAAGACCGGTTGCTCGGCAAGAACTACTTGCGGTTG[T/C]
GAGCGTCGATGAAGGCGCGCAGCACGCGAGTGGAGAGGAAGGTGAACCGTCGCGGTTGAACAGGGAACAGTCGCACGAAGCGCTTCCCAAAAACCTTATT

Reverse complement sequence

AATAAGGTTTTTGGGAAGCGCTTCGTGCGACTGTTCCCTGTTCAACCGCGACGGTTCACCTTCCTCTCCACTCGCGTGCTGCGCGCCTTCATCGACGCTC[A/G]
CAACCGCAAGTAGTTCTTGCCGAGCAACCGGTCTTTCCGCCACCTCGGTACGTGTTCGACATGTTGCGCATATTTGATCTGTTCATGTTTTACTGCTTAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.80% 28.60% 3.49% 2.16% NA
All Indica  2759 91.80% 1.20% 5.51% 1.52% NA
All Japonica  1512 16.70% 79.00% 0.33% 3.90% NA
Aus  269 98.90% 0.00% 1.12% 0.00% NA
Indica I  595 89.10% 0.70% 8.91% 1.34% NA
Indica II  465 87.30% 1.70% 7.53% 3.44% NA
Indica III  913 96.20% 0.90% 2.41% 0.55% NA
Indica Intermediate  786 91.50% 1.50% 5.34% 1.65% NA
Temperate Japonica  767 5.30% 87.10% 0.26% 7.30% NA
Tropical Japonica  504 33.10% 66.70% 0.20% 0.00% NA
Japonica Intermediate  241 18.70% 79.30% 0.83% 1.24% NA
VI/Aromatic  96 11.50% 88.50% 0.00% 0.00% NA
Intermediate  90 51.10% 42.20% 5.56% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0811513583 T -> C LOC_Os08g19240.1 upstream_gene_variant ; 2662.0bp to feature; MODIFIER silent_mutation Average:35.185; most accessible tissue: Zhenshan97 flag leaf, score: 47.303 N N N N
vg0811513583 T -> C LOC_Os08g19250.1 intron_variant ; MODIFIER silent_mutation Average:35.185; most accessible tissue: Zhenshan97 flag leaf, score: 47.303 N N N N
vg0811513583 T -> DEL N N silent_mutation Average:35.185; most accessible tissue: Zhenshan97 flag leaf, score: 47.303 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0811513583 NA 4.93E-10 Grain_weight All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0811513583 NA 1.54E-31 mr1074 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811513583 6.39E-06 NA mr1134 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811513583 NA 1.02E-06 mr1134 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811513583 NA 3.05E-74 mr1135 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811513583 NA 9.53E-15 mr1276 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811513583 4.44E-06 NA mr1504 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811513583 NA 9.05E-07 mr1504 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811513583 NA 2.37E-07 mr1659 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811513583 NA 1.11E-08 mr1660 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811513583 NA 3.68E-34 mr1670 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811513583 3.97E-06 5.56E-83 mr1672 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811513583 NA 4.46E-07 mr1672 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811513583 NA 7.21E-10 mr1714 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811513583 NA 1.61E-06 mr1835 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811513583 NA 3.20E-10 mr1595_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811513583 NA 5.67E-06 mr1672_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251