Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0811513583:

Variant ID: vg0811513583 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 11513583
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTAAGCAGTAAAACATGAACAGATCAAATATGCGCAACATGTCGAACACGTACCGAGGTGGCGGAAAGACCGGTTGCTCGGCAAGAACTACTTGCGGTTG[T/C]
GAGCGTCGATGAAGGCGCGCAGCACGCGAGTGGAGAGGAAGGTGAACCGTCGCGGTTGAACAGGGAACAGTCGCACGAAGCGCTTCCCAAAAACCTTATT

Reverse complement sequence

AATAAGGTTTTTGGGAAGCGCTTCGTGCGACTGTTCCCTGTTCAACCGCGACGGTTCACCTTCCTCTCCACTCGCGTGCTGCGCGCCTTCATCGACGCTC[A/G]
CAACCGCAAGTAGTTCTTGCCGAGCAACCGGTCTTTCCGCCACCTCGGTACGTGTTCGACATGTTGCGCATATTTGATCTGTTCATGTTTTACTGCTTAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	65.80%	28.60%	3.49%	2.16%	NA
All Indica	2759	91.80%	1.20%	5.51%	1.52%	NA
All Japonica	1512	16.70%	79.00%	0.33%	3.90%	NA
Aus	269	98.90%	0.00%	1.12%	0.00%	NA
Indica I	595	89.10%	0.70%	8.91%	1.34%	NA
Indica II	465	87.30%	1.70%	7.53%	3.44%	NA
Indica III	913	96.20%	0.90%	2.41%	0.55%	NA
Indica Intermediate	786	91.50%	1.50%	5.34%	1.65%	NA
Temperate Japonica	767	5.30%	87.10%	0.26%	7.30%	NA
Tropical Japonica	504	33.10%	66.70%	0.20%	0.00%	NA
Japonica Intermediate	241	18.70%	79.30%	0.83%	1.24%	NA
VI/Aromatic	96	11.50%	88.50%	0.00%	0.00%	NA
Intermediate	90	51.10%	42.20%	5.56%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0811513583	T -> C	LOC_Os08g19240.1	upstream_gene_variant ; 2662.0bp to feature; MODIFIER	silent_mutation	Average:35.185; most accessible tissue: Zhenshan97 flag leaf, score: 47.303	N	N	N	N
vg0811513583	T -> C	LOC_Os08g19250.1	intron_variant ; MODIFIER	silent_mutation	Average:35.185; most accessible tissue: Zhenshan97 flag leaf, score: 47.303	N	N	N	N
vg0811513583	T -> DEL	N	N	silent_mutation	Average:35.185; most accessible tissue: Zhenshan97 flag leaf, score: 47.303	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0811513583	NA	4.93E-10	Grain_weight	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0811513583	NA	1.54E-31	mr1074	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811513583	6.39E-06	NA	mr1134	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811513583	NA	1.02E-06	mr1134	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811513583	NA	3.05E-74	mr1135	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811513583	NA	9.53E-15	mr1276	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811513583	4.44E-06	NA	mr1504	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811513583	NA	9.05E-07	mr1504	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811513583	NA	2.37E-07	mr1659	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811513583	NA	1.11E-08	mr1660	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811513583	NA	3.68E-34	mr1670	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811513583	3.97E-06	5.56E-83	mr1672	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811513583	NA	4.46E-07	mr1672	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811513583	NA	7.21E-10	mr1714	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811513583	NA	1.61E-06	mr1835	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811513583	NA	3.20E-10	mr1595_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811513583	NA	5.67E-06	mr1672_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251