\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0811469683:

Variant ID: vg0811469683 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 11469683
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CATATACGAGTTCACCCTCTCTACGACTTTGATCCATCCGCTTCGTCGTCCAAGCCACTCTCGTCGTCGACGCCGGGGCCTTCGATTTGTCCGTGTTTTA[C/A]
GGCGCCACCAATCCTGCAATCCAGCCACGGCGCCGTGTGCATTGGCAGCTCTCTCGTCGTGAGCAATAGGTTTGCCCTGCAATTTATATCATGCATGCAT

Reverse complement sequence

ATGCATGCATGATATAAATTGCAGGGCAAACCTATTGCTCACGACGAGAGAGCTGCCAATGCACACGGCGCCGTGGCTGGATTGCAGGATTGGTGGCGCC[G/T]
TAAAACACGGACAAATCGAAGGCCCCGGCGTCGACGACGAGAGTGGCTTGGACGACGAAGCGGATGGATCAAAGTCGTAGAGAGGGTGAACTCGTATATG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.70% 19.40% 1.59% 0.30% NA
All Indica  2759 90.80% 6.30% 2.46% 0.51% NA
All Japonica  1512 57.90% 41.90% 0.20% 0.00% NA
Aus  269 99.30% 0.40% 0.37% 0.00% NA
Indica I  595 97.60% 1.20% 1.18% 0.00% NA
Indica II  465 95.10% 3.90% 1.08% 0.00% NA
Indica III  913 83.70% 11.10% 3.94% 1.31% NA
Indica Intermediate  786 91.20% 6.00% 2.54% 0.25% NA
Temperate Japonica  767 89.70% 10.30% 0.00% 0.00% NA
Tropical Japonica  504 16.50% 83.10% 0.40% 0.00% NA
Japonica Intermediate  241 43.60% 56.00% 0.41% 0.00% NA
VI/Aromatic  96 10.40% 88.50% 1.04% 0.00% NA
Intermediate  90 68.90% 28.90% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0811469683 C -> A LOC_Os08g19170.1 upstream_gene_variant ; 877.0bp to feature; MODIFIER silent_mutation Average:62.799; most accessible tissue: Minghui63 flag leaf, score: 77.494 N N N N
vg0811469683 C -> A LOC_Os08g19180.1 upstream_gene_variant ; 455.0bp to feature; MODIFIER silent_mutation Average:62.799; most accessible tissue: Minghui63 flag leaf, score: 77.494 N N N N
vg0811469683 C -> A LOC_Os08g19190.1 downstream_gene_variant ; 3805.0bp to feature; MODIFIER silent_mutation Average:62.799; most accessible tissue: Minghui63 flag leaf, score: 77.494 N N N N
vg0811469683 C -> A LOC_Os08g19170-LOC_Os08g19180 intergenic_region ; MODIFIER silent_mutation Average:62.799; most accessible tissue: Minghui63 flag leaf, score: 77.494 N N N N
vg0811469683 C -> DEL N N silent_mutation Average:62.799; most accessible tissue: Minghui63 flag leaf, score: 77.494 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0811469683 NA 3.24E-06 mr1045 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811469683 NA 3.15E-09 mr1206 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811469683 NA 2.57E-07 mr1206 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811469683 NA 1.97E-06 mr1229 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811469683 5.44E-07 2.18E-09 mr1238 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811469683 NA 6.21E-07 mr1309 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811469683 1.84E-06 5.29E-07 mr1484 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811469683 NA 3.00E-07 mr1596 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811469683 NA 7.72E-07 mr1668 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811469683 NA 1.34E-07 mr1824 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811469683 4.87E-06 5.24E-09 mr1841 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811469683 NA 5.11E-06 mr1851 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811469683 NA 4.83E-08 mr1864 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811469683 1.94E-06 1.94E-06 mr1900 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811469683 2.20E-06 8.08E-09 mr1238_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811469683 9.06E-06 5.10E-08 mr1484_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811469683 NA 5.52E-08 mr1671_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811469683 9.99E-07 1.48E-10 mr1841_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811469683 NA 3.36E-08 mr1900_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251