Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0811469683:

Variant ID: vg0811469683 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 11469683
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CATATACGAGTTCACCCTCTCTACGACTTTGATCCATCCGCTTCGTCGTCCAAGCCACTCTCGTCGTCGACGCCGGGGCCTTCGATTTGTCCGTGTTTTA[C/A]
GGCGCCACCAATCCTGCAATCCAGCCACGGCGCCGTGTGCATTGGCAGCTCTCTCGTCGTGAGCAATAGGTTTGCCCTGCAATTTATATCATGCATGCAT

Reverse complement sequence

ATGCATGCATGATATAAATTGCAGGGCAAACCTATTGCTCACGACGAGAGAGCTGCCAATGCACACGGCGCCGTGGCTGGATTGCAGGATTGGTGGCGCC[G/T]
TAAAACACGGACAAATCGAAGGCCCCGGCGTCGACGACGAGAGTGGCTTGGACGACGAAGCGGATGGATCAAAGTCGTAGAGAGGGTGAACTCGTATATG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	78.70%	19.40%	1.59%	0.30%	NA
All Indica	2759	90.80%	6.30%	2.46%	0.51%	NA
All Japonica	1512	57.90%	41.90%	0.20%	0.00%	NA
Aus	269	99.30%	0.40%	0.37%	0.00%	NA
Indica I	595	97.60%	1.20%	1.18%	0.00%	NA
Indica II	465	95.10%	3.90%	1.08%	0.00%	NA
Indica III	913	83.70%	11.10%	3.94%	1.31%	NA
Indica Intermediate	786	91.20%	6.00%	2.54%	0.25%	NA
Temperate Japonica	767	89.70%	10.30%	0.00%	0.00%	NA
Tropical Japonica	504	16.50%	83.10%	0.40%	0.00%	NA
Japonica Intermediate	241	43.60%	56.00%	0.41%	0.00%	NA
VI/Aromatic	96	10.40%	88.50%	1.04%	0.00%	NA
Intermediate	90	68.90%	28.90%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0811469683	C -> A	LOC_Os08g19170.1	upstream_gene_variant ; 877.0bp to feature; MODIFIER	silent_mutation	Average:62.799; most accessible tissue: Minghui63 flag leaf, score: 77.494	N	N	N	N
vg0811469683	C -> A	LOC_Os08g19180.1	upstream_gene_variant ; 455.0bp to feature; MODIFIER	silent_mutation	Average:62.799; most accessible tissue: Minghui63 flag leaf, score: 77.494	N	N	N	N
vg0811469683	C -> A	LOC_Os08g19190.1	downstream_gene_variant ; 3805.0bp to feature; MODIFIER	silent_mutation	Average:62.799; most accessible tissue: Minghui63 flag leaf, score: 77.494	N	N	N	N
vg0811469683	C -> A	LOC_Os08g19170-LOC_Os08g19180	intergenic_region ; MODIFIER	silent_mutation	Average:62.799; most accessible tissue: Minghui63 flag leaf, score: 77.494	N	N	N	N
vg0811469683	C -> DEL	N	N	silent_mutation	Average:62.799; most accessible tissue: Minghui63 flag leaf, score: 77.494	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0811469683	NA	3.24E-06	mr1045	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811469683	NA	3.15E-09	mr1206	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811469683	NA	2.57E-07	mr1206	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811469683	NA	1.97E-06	mr1229	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811469683	5.44E-07	2.18E-09	mr1238	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811469683	NA	6.21E-07	mr1309	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811469683	1.84E-06	5.29E-07	mr1484	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811469683	NA	3.00E-07	mr1596	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811469683	NA	7.72E-07	mr1668	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811469683	NA	1.34E-07	mr1824	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811469683	4.87E-06	5.24E-09	mr1841	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811469683	NA	5.11E-06	mr1851	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811469683	NA	4.83E-08	mr1864	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811469683	1.94E-06	1.94E-06	mr1900	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811469683	2.20E-06	8.08E-09	mr1238_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811469683	9.06E-06	5.10E-08	mr1484_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811469683	NA	5.52E-08	mr1671_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811469683	9.99E-07	1.48E-10	mr1841_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811469683	NA	3.36E-08	mr1900_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251