\
| Variant ID: vg0811459294 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 11459294 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.66, A: 0.34, others allele: 0.00, population size: 218. )
GAGCCTATTGGAGTGAGGAATGAGTTTGGGTTACCAAATCAATTGGAAAGCTGACTATATAAGTGTTTGGAGAGTCCGATTTGGAGAGGCTATTGGAGAT[G/A]
CTGTTACATGGAGCAAATCTTGCTAATCAAACAAATCCAATATATCCATGGTTGCATCTTTGGCGACCACAAGGCCTGCTAGTTTCTTCTTGTGCTGGAA
TTCCAGCACAAGAAGAAACTAGCAGGCCTTGTGGTCGCCAAAGATGCAACCATGGATATATTGGATTTGTTTGATTAGCAAGATTTGCTCCATGTAACAG[C/T]
ATCTCCAATAGCCTCTCCAAATCGGACTCTCCAAACACTTATATAGTCAGCTTTCCAATTGATTTGGTAACCCAAACTCATTCCTCACTCCAATAGGCTC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 59.50% | 40.10% | 0.34% | 0.04% | NA |
| All Indica | 2759 | 86.80% | 12.70% | 0.43% | 0.07% | NA |
| All Japonica | 1512 | 6.60% | 93.30% | 0.13% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.30% | 2.40% | 0.34% | 0.00% | NA |
| Indica II | 465 | 93.30% | 6.50% | 0.22% | 0.00% | NA |
| Indica III | 913 | 74.30% | 24.90% | 0.77% | 0.11% | NA |
| Indica Intermediate | 786 | 89.60% | 10.10% | 0.25% | 0.13% | NA |
| Temperate Japonica | 767 | 5.00% | 95.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 6.50% | 93.50% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 12.00% | 87.10% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 6.20% | 93.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 47.80% | 50.00% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0811459294 | G -> A | LOC_Os08g19150.1 | upstream_gene_variant ; 128.0bp to feature; MODIFIER | silent_mutation | Average:72.863; most accessible tissue: Zhenshan97 young leaf, score: 85.542 | N | N | N | N |
| vg0811459294 | G -> A | LOC_Os08g19160.1 | upstream_gene_variant ; 1063.0bp to feature; MODIFIER | silent_mutation | Average:72.863; most accessible tissue: Zhenshan97 young leaf, score: 85.542 | N | N | N | N |
| vg0811459294 | G -> A | LOC_Os08g19170.1 | downstream_gene_variant ; 3822.0bp to feature; MODIFIER | silent_mutation | Average:72.863; most accessible tissue: Zhenshan97 young leaf, score: 85.542 | N | N | N | N |
| vg0811459294 | G -> A | LOC_Os08g19150-LOC_Os08g19160 | intergenic_region ; MODIFIER | silent_mutation | Average:72.863; most accessible tissue: Zhenshan97 young leaf, score: 85.542 | N | N | N | N |
| vg0811459294 | G -> DEL | N | N | silent_mutation | Average:72.863; most accessible tissue: Zhenshan97 young leaf, score: 85.542 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0811459294 | 7.90E-06 | 8.17E-09 | mr1238 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811459294 | NA | 2.08E-07 | mr1309 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811459294 | 4.74E-06 | 5.23E-10 | mr1841 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811459294 | NA | 2.26E-13 | mr1900 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811459294 | 8.81E-08 | 8.81E-08 | mr1900 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811459294 | 1.91E-06 | 2.13E-09 | mr1238_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811459294 | 7.07E-08 | 6.95E-10 | mr1484_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811459294 | NA | 1.02E-11 | mr1595_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811459294 | NA | 7.95E-09 | mr1600_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811459294 | NA | 9.85E-10 | mr1841_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811459294 | NA | 4.92E-20 | mr1900_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811459294 | NA | 5.34E-08 | mr1900_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811459294 | 4.50E-06 | 4.50E-06 | mr1945_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |