\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0811459294:

Variant ID: vg0811459294 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 11459294
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.66, A: 0.34, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:


GAGCCTATTGGAGTGAGGAATGAGTTTGGGTTACCAAATCAATTGGAAAGCTGACTATATAAGTGTTTGGAGAGTCCGATTTGGAGAGGCTATTGGAGAT[G/A]
CTGTTACATGGAGCAAATCTTGCTAATCAAACAAATCCAATATATCCATGGTTGCATCTTTGGCGACCACAAGGCCTGCTAGTTTCTTCTTGTGCTGGAA

Reverse complement sequence

TTCCAGCACAAGAAGAAACTAGCAGGCCTTGTGGTCGCCAAAGATGCAACCATGGATATATTGGATTTGTTTGATTAGCAAGATTTGCTCCATGTAACAG[C/T]
ATCTCCAATAGCCTCTCCAAATCGGACTCTCCAAACACTTATATAGTCAGCTTTCCAATTGATTTGGTAACCCAAACTCATTCCTCACTCCAATAGGCTC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.50% 40.10% 0.34% 0.04% NA
All Indica  2759 86.80% 12.70% 0.43% 0.07% NA
All Japonica  1512 6.60% 93.30% 0.13% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 97.30% 2.40% 0.34% 0.00% NA
Indica II  465 93.30% 6.50% 0.22% 0.00% NA
Indica III  913 74.30% 24.90% 0.77% 0.11% NA
Indica Intermediate  786 89.60% 10.10% 0.25% 0.13% NA
Temperate Japonica  767 5.00% 95.00% 0.00% 0.00% NA
Tropical Japonica  504 6.50% 93.50% 0.00% 0.00% NA
Japonica Intermediate  241 12.00% 87.10% 0.83% 0.00% NA
VI/Aromatic  96 6.20% 93.80% 0.00% 0.00% NA
Intermediate  90 47.80% 50.00% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0811459294 G -> A LOC_Os08g19150.1 upstream_gene_variant ; 128.0bp to feature; MODIFIER silent_mutation Average:72.863; most accessible tissue: Zhenshan97 young leaf, score: 85.542 N N N N
vg0811459294 G -> A LOC_Os08g19160.1 upstream_gene_variant ; 1063.0bp to feature; MODIFIER silent_mutation Average:72.863; most accessible tissue: Zhenshan97 young leaf, score: 85.542 N N N N
vg0811459294 G -> A LOC_Os08g19170.1 downstream_gene_variant ; 3822.0bp to feature; MODIFIER silent_mutation Average:72.863; most accessible tissue: Zhenshan97 young leaf, score: 85.542 N N N N
vg0811459294 G -> A LOC_Os08g19150-LOC_Os08g19160 intergenic_region ; MODIFIER silent_mutation Average:72.863; most accessible tissue: Zhenshan97 young leaf, score: 85.542 N N N N
vg0811459294 G -> DEL N N silent_mutation Average:72.863; most accessible tissue: Zhenshan97 young leaf, score: 85.542 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0811459294 7.90E-06 8.17E-09 mr1238 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811459294 NA 2.08E-07 mr1309 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811459294 4.74E-06 5.23E-10 mr1841 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811459294 NA 2.26E-13 mr1900 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811459294 8.81E-08 8.81E-08 mr1900 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811459294 1.91E-06 2.13E-09 mr1238_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811459294 7.07E-08 6.95E-10 mr1484_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811459294 NA 1.02E-11 mr1595_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811459294 NA 7.95E-09 mr1600_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811459294 NA 9.85E-10 mr1841_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811459294 NA 4.92E-20 mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811459294 NA 5.34E-08 mr1900_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811459294 4.50E-06 4.50E-06 mr1945_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251