Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0811404383:

Variant ID: vg0811404383 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 11404383
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:

AGAGGACCGTACGGAAAAATCAATTTTTCCGTGCGATCCTCTTAAATGGACCGCACGGGAAAATGAACCCATTTTTCCGTGCGGAACAAGTTACCGTCCG[C/T]
ACGCAACTCTGTCCAGGAAAATCATTTACGTAGTAGTGAAAGTAAAAGATCAAACTTCTGTTGCTTCTTCCAATACTAGTACTAGATATCTTAAAGCGCA

Reverse complement sequence

TGCGCTTTAAGATATCTAGTACTAGTATTGGAAGAAGCAACAGAAGTTTGATCTTTTACTTTCACTACTACGTAAATGATTTTCCTGGACAGAGTTGCGT[G/A]
CGGACGGTAACTTGTTCCGCACGGAAAAATGGGTTCATTTTCCCGTGCGGTCCATTTAAGAGGATCGCACGGAAAAATTGATTTTTCCGTACGGTCCTCT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	79.80%	8.30%	1.27%	10.73%	NA
All Indica	2759	90.00%	8.20%	1.78%	0.11%	NA
All Japonica	1512	62.20%	10.00%	0.53%	27.25%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	88.40%	9.40%	2.18%	0.00%	NA
Indica II	465	96.10%	3.40%	0.22%	0.22%	NA
Indica III	913	86.40%	12.00%	1.42%	0.11%	NA
Indica Intermediate	786	91.60%	5.50%	2.80%	0.13%	NA
Temperate Japonica	767	97.50%	0.30%	0.00%	2.22%	NA
Tropical Japonica	504	17.10%	26.40%	0.99%	55.56%	NA
Japonica Intermediate	241	44.40%	6.60%	1.24%	47.72%	NA
VI/Aromatic	96	13.50%	6.20%	3.12%	77.08%	NA
Intermediate	90	71.10%	8.90%	0.00%	20.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0811404383	C -> T	LOC_Os08g19105.1	upstream_gene_variant ; 1521.0bp to feature; MODIFIER	silent_mutation	Average:96.923; most accessible tissue: Zhenshan97 root, score: 98.207	N	N	N	N
vg0811404383	C -> T	LOC_Os08g19114.1	upstream_gene_variant ; 316.0bp to feature; MODIFIER	silent_mutation	Average:96.923; most accessible tissue: Zhenshan97 root, score: 98.207	N	N	N	N
vg0811404383	C -> T	LOC_Os08g19114.2	upstream_gene_variant ; 3322.0bp to feature; MODIFIER	silent_mutation	Average:96.923; most accessible tissue: Zhenshan97 root, score: 98.207	N	N	N	N
vg0811404383	C -> T	LOC_Os08g19110.1	intron_variant ; MODIFIER	silent_mutation	Average:96.923; most accessible tissue: Zhenshan97 root, score: 98.207	N	N	N	N
vg0811404383	C -> DEL	N	N	silent_mutation	Average:96.923; most accessible tissue: Zhenshan97 root, score: 98.207	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0811404383	C	T	0.0	0.0	0.0	0.01	0.0	0.0

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0811404383	NA	1.22E-06	mr1583	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811404383	4.72E-06	1.09E-06	mr1159_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811404383	NA	9.76E-06	mr1184_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811404383	NA	8.02E-06	mr1278_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811404383	NA	2.58E-06	mr1284_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811404383	6.67E-06	6.67E-06	mr1286_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811404383	NA	6.31E-06	mr1374_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811404383	NA	4.61E-06	mr1397_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811404383	NA	6.41E-06	mr1843_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811404383	2.88E-06	2.88E-06	mr1847_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811404383	3.74E-06	3.73E-06	mr1979_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251