Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0811355397:

Variant ID: vg0811355397 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 11355397
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.69, C: 0.32, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:

GCCAACATGTGCATAAAGTCCAAATAATAAAATATCCAACATAGTGATAGGTGTTAAACCTCACATATTCCACAAGTGTTGGTGTATATTTGTATGCATG[T/C]
GTTAAACCCCAAAGTTGGGAGGAAATCTAGACTAAAATGAGGAGAAACATGTATCCATACAAGGATGGGTTGTGAACTTGATCAAAGTACCAGAGAATCA

Reverse complement sequence

TGATTCTCTGGTACTTTGATCAAGTTCACAACCCATCCTTGTATGGATACATGTTTCTCCTCATTTTAGTCTAGATTTCCTCCCAACTTTGGGGTTTAAC[A/G]
CATGCATACAAATATACACCAACACTTGTGGAATATGTGAGGTTTAACACCTATCACTATGTTGGATATTTTATTATTTGGACTTTATGCACATGTTGGC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.70%	36.90%	0.17%	4.27%	NA
All Indica	2759	85.20%	14.20%	0.04%	0.58%	NA
All Japonica	1512	7.00%	81.30%	0.13%	11.57%	NA
Aus	269	98.50%	0.70%	0.74%	0.00%	NA
Indica I	595	95.80%	3.90%	0.17%	0.17%	NA
Indica II	465	89.50%	10.30%	0.00%	0.22%	NA
Indica III	913	73.40%	25.60%	0.00%	0.99%	NA
Indica Intermediate	786	88.40%	10.90%	0.00%	0.64%	NA
Temperate Japonica	767	5.10%	94.70%	0.00%	0.26%	NA
Tropical Japonica	504	7.10%	61.10%	0.40%	31.35%	NA
Japonica Intermediate	241	12.90%	80.90%	0.00%	6.22%	NA
VI/Aromatic	96	8.30%	85.40%	3.12%	3.12%	NA
Intermediate	90	46.70%	44.40%	0.00%	8.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0811355397	T -> C	LOC_Os08g19020.1	upstream_gene_variant ; 1232.0bp to feature; MODIFIER	silent_mutation	Average:57.157; most accessible tissue: Minghui63 flag leaf, score: 80.786	N	N	N	N
vg0811355397	T -> C	LOC_Os08g19010.1	downstream_gene_variant ; 4919.0bp to feature; MODIFIER	silent_mutation	Average:57.157; most accessible tissue: Minghui63 flag leaf, score: 80.786	N	N	N	N
vg0811355397	T -> C	LOC_Os08g19010-LOC_Os08g19020	intergenic_region ; MODIFIER	silent_mutation	Average:57.157; most accessible tissue: Minghui63 flag leaf, score: 80.786	N	N	N	N
vg0811355397	T -> DEL	N	N	silent_mutation	Average:57.157; most accessible tissue: Minghui63 flag leaf, score: 80.786	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0811355397	NA	7.14E-06	mr1080	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811355397	NA	8.04E-08	mr1238	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811355397	NA	4.74E-06	mr1309	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811355397	4.31E-06	5.28E-07	mr1613	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811355397	NA	1.63E-06	mr1672	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811355397	NA	3.04E-08	mr1841	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811355397	1.30E-06	1.30E-06	mr1900	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811355397	NA	3.05E-11	mr1595_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811355397	NA	1.16E-08	mr1600_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811355397	NA	3.05E-06	mr1672_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251