Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0811336981:

Variant ID: vg0811336981 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 11336981
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 272. )

Flanking Sequence (100 bp) in Reference Genome:

TTATCCCTCTCCCCTACTTCCGTAGGTGCCGTCGTCGCTCGTCCACCCCTCCCTTCGCTGAACCGGTGCTGCCATCACCGTCGTTGTCATCATCTTCCCC[G/A]
CGCTAGTCGCCACCATCCCTAGCATATTGTTTAATTTACTTCAATAGTTTTATTGTTTTCAACTACTGGTTTATAACCGCTTTATGCAAAAGAATCCCTA

Reverse complement sequence

TAGGGATTCTTTTGCATAAAGCGGTTATAAACCAGTAGTTGAAAACAATAAAACTATTGAAGTAAATTAAACAATATGCTAGGGATGGTGGCGACTAGCG[C/T]
GGGGAAGATGATGACAACGACGGTGATGGCAGCACCGGTTCAGCGAAGGGAGGGGTGGACGAGCGACGACGGCACCTACGGAAGTAGGGGAGAGGGATAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	94.10%	1.90%	0.83%	3.24%	NA
All Indica	2759	99.90%	0.00%	0.00%	0.07%	NA
All Japonica	1512	82.50%	5.60%	2.45%	9.39%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.60%	0.20%	0.00%	0.22%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.90%	0.00%	0.00%	0.13%	NA
Temperate Japonica	767	98.70%	0.70%	0.39%	0.26%	NA
Tropical Japonica	504	56.70%	13.10%	5.36%	24.80%	NA
Japonica Intermediate	241	85.10%	5.80%	2.90%	6.22%	NA
VI/Aromatic	96	93.80%	0.00%	1.04%	5.21%	NA
Intermediate	90	91.10%	3.30%	1.11%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0811336981	G -> A	LOC_Os08g18990.1	upstream_gene_variant ; 628.0bp to feature; MODIFIER	silent_mutation	Average:61.501; most accessible tissue: Zhenshan97 young leaf, score: 86.383	N	N	N	N
vg0811336981	G -> A	LOC_Os08g19000.1	downstream_gene_variant ; 2918.0bp to feature; MODIFIER	silent_mutation	Average:61.501; most accessible tissue: Zhenshan97 young leaf, score: 86.383	N	N	N	N
vg0811336981	G -> A	LOC_Os08g18990-LOC_Os08g19000	intergenic_region ; MODIFIER	silent_mutation	Average:61.501; most accessible tissue: Zhenshan97 young leaf, score: 86.383	N	N	N	N
vg0811336981	G -> DEL	N	N	silent_mutation	Average:61.501; most accessible tissue: Zhenshan97 young leaf, score: 86.383	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0811336981	NA	8.59E-07	mr1040	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811336981	NA	2.35E-06	mr1104	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811336981	NA	3.29E-06	mr1213	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811336981	NA	7.37E-07	mr1224	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811336981	NA	1.93E-06	mr1277	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811336981	NA	2.43E-06	mr1437	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811336981	2.45E-06	NA	mr1560	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811336981	NA	2.26E-08	mr1951	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811336981	NA	6.78E-09	mr1676_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251