\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0811336981:

Variant ID: vg0811336981 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 11336981
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 272. )

Flanking Sequence (100 bp) in Reference Genome:


TTATCCCTCTCCCCTACTTCCGTAGGTGCCGTCGTCGCTCGTCCACCCCTCCCTTCGCTGAACCGGTGCTGCCATCACCGTCGTTGTCATCATCTTCCCC[G/A]
CGCTAGTCGCCACCATCCCTAGCATATTGTTTAATTTACTTCAATAGTTTTATTGTTTTCAACTACTGGTTTATAACCGCTTTATGCAAAAGAATCCCTA

Reverse complement sequence

TAGGGATTCTTTTGCATAAAGCGGTTATAAACCAGTAGTTGAAAACAATAAAACTATTGAAGTAAATTAAACAATATGCTAGGGATGGTGGCGACTAGCG[C/T]
GGGGAAGATGATGACAACGACGGTGATGGCAGCACCGGTTCAGCGAAGGGAGGGGTGGACGAGCGACGACGGCACCTACGGAAGTAGGGGAGAGGGATAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.10% 1.90% 0.83% 3.24% NA
All Indica  2759 99.90% 0.00% 0.00% 0.07% NA
All Japonica  1512 82.50% 5.60% 2.45% 9.39% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.60% 0.20% 0.00% 0.22% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.90% 0.00% 0.00% 0.13% NA
Temperate Japonica  767 98.70% 0.70% 0.39% 0.26% NA
Tropical Japonica  504 56.70% 13.10% 5.36% 24.80% NA
Japonica Intermediate  241 85.10% 5.80% 2.90% 6.22% NA
VI/Aromatic  96 93.80% 0.00% 1.04% 5.21% NA
Intermediate  90 91.10% 3.30% 1.11% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0811336981 G -> A LOC_Os08g18990.1 upstream_gene_variant ; 628.0bp to feature; MODIFIER silent_mutation Average:61.501; most accessible tissue: Zhenshan97 young leaf, score: 86.383 N N N N
vg0811336981 G -> A LOC_Os08g19000.1 downstream_gene_variant ; 2918.0bp to feature; MODIFIER silent_mutation Average:61.501; most accessible tissue: Zhenshan97 young leaf, score: 86.383 N N N N
vg0811336981 G -> A LOC_Os08g18990-LOC_Os08g19000 intergenic_region ; MODIFIER silent_mutation Average:61.501; most accessible tissue: Zhenshan97 young leaf, score: 86.383 N N N N
vg0811336981 G -> DEL N N silent_mutation Average:61.501; most accessible tissue: Zhenshan97 young leaf, score: 86.383 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0811336981 NA 8.59E-07 mr1040 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811336981 NA 2.35E-06 mr1104 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811336981 NA 3.29E-06 mr1213 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811336981 NA 7.37E-07 mr1224 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811336981 NA 1.93E-06 mr1277 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811336981 NA 2.43E-06 mr1437 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811336981 2.45E-06 NA mr1560 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811336981 NA 2.26E-08 mr1951 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811336981 NA 6.78E-09 mr1676_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251