\
| Variant ID: vg0811308449 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 11308449 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 277. )
CACAGAATGAGAGAAGAGAGCAGTTAGGGACCGGAGAGAAGTAGAAAACCAAGAGAGGAGAGAGGAGCAGAGATAGGTGTGTACGGTGTACCTGCGCATC[T/C]
GGAGCACCGGAGTTGCCGTTGATGATAGAGATCAACGGATCTACAAGAAGAAGATAGCAGAGACTGGGTTTGGGGAGTGATGTGACAAAGAGCTCACGAA
TTCGTGAGCTCTTTGTCACATCACTCCCCAAACCCAGTCTCTGCTATCTTCTTCTTGTAGATCCGTTGATCTCTATCATCAACGGCAACTCCGGTGCTCC[A/G]
GATGCGCAGGTACACCGTACACACCTATCTCTGCTCCTCTCTCCTCTCTTGGTTTTCTACTTCTCTCCGGTCCCTAACTGCTCTCTTCTCTCATTCTGTG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 70.80% | 29.20% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 17.10% | 82.80% | 0.07% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 5.30% | 94.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 33.70% | 66.30% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 19.90% | 79.70% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 13.50% | 86.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 62.20% | 36.70% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0811308449 | T -> C | LOC_Os08g18950.1 | upstream_gene_variant ; 3841.0bp to feature; MODIFIER | silent_mutation | Average:59.928; most accessible tissue: Minghui63 panicle, score: 75.788 | N | N | N | N |
| vg0811308449 | T -> C | LOC_Os08g18960.1 | upstream_gene_variant ; 154.0bp to feature; MODIFIER | silent_mutation | Average:59.928; most accessible tissue: Minghui63 panicle, score: 75.788 | N | N | N | N |
| vg0811308449 | T -> C | LOC_Os08g18970.1 | upstream_gene_variant ; 2231.0bp to feature; MODIFIER | silent_mutation | Average:59.928; most accessible tissue: Minghui63 panicle, score: 75.788 | N | N | N | N |
| vg0811308449 | T -> C | LOC_Os08g18960-LOC_Os08g18970 | intergenic_region ; MODIFIER | silent_mutation | Average:59.928; most accessible tissue: Minghui63 panicle, score: 75.788 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0811308449 | NA | 5.70E-10 | Grain_weight | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0811308449 | NA | 2.08E-31 | mr1074 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811308449 | 6.16E-06 | NA | mr1134 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811308449 | NA | 1.02E-06 | mr1134 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811308449 | 3.45E-06 | 2.19E-76 | mr1135 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811308449 | NA | 7.20E-21 | mr1217 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811308449 | NA | 3.57E-10 | mr1307 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811308449 | 6.21E-06 | 7.60E-85 | mr1504 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811308449 | NA | 9.05E-07 | mr1504 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811308449 | NA | 1.97E-07 | mr1659 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811308449 | NA | 3.68E-08 | mr1660 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811308449 | NA | 6.69E-34 | mr1670 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811308449 | 7.83E-07 | 5.38E-86 | mr1672 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811308449 | NA | 4.46E-07 | mr1672 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811308449 | NA | 8.73E-10 | mr1714 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811308449 | NA | 5.61E-06 | mr1835 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811308449 | NA | 1.69E-10 | mr1595_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811308449 | NA | 5.67E-06 | mr1672_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |