\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0811281856:

Variant ID: vg0811281856 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 11281856
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.80, A: 0.21, others allele: 0.00, population size: 186. )

Flanking Sequence (100 bp) in Reference Genome:


ATTTGGAGATGATGCCAATGGGATGTACATTCTCCTTGTCCAATCTTAGGGCTTGTTCAGTTTGTAGGATTATCAAAATGTAGAAAAAGAGAAAAGATAG[G/A]
AATAATATAGGAATGCATGTGCAAACCTAAGGATTGGAAAACATATGAAATTTTCCAATGGTTATGTAGCAAACAATCCAAAGGATTGAAAACATTGGGT

Reverse complement sequence

ACCCAATGTTTTCAATCCTTTGGATTGTTTGCTACATAACCATTGGAAAATTTCATATGTTTTCCAATCCTTAGGTTTGCACATGCATTCCTATATTATT[C/T]
CTATCTTTTCTCTTTTTCTACATTTTGATAATCCTACAAACTGAACAAGCCCTAAGATTGGACAAGGAGAATGTACATCCCATTGGCATCATCTCCAAAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.00% 43.70% 0.28% 0.08% NA
All Indica  2759 85.50% 14.00% 0.33% 0.14% NA
All Japonica  1512 6.70% 93.30% 0.00% 0.00% NA
Aus  269 52.80% 46.80% 0.37% 0.00% NA
Indica I  595 97.60% 2.40% 0.00% 0.00% NA
Indica II  465 91.20% 8.80% 0.00% 0.00% NA
Indica III  913 72.50% 26.60% 0.55% 0.33% NA
Indica Intermediate  786 88.20% 11.20% 0.51% 0.13% NA
Temperate Japonica  767 5.10% 94.90% 0.00% 0.00% NA
Tropical Japonica  504 6.30% 93.70% 0.00% 0.00% NA
Japonica Intermediate  241 12.90% 87.10% 0.00% 0.00% NA
VI/Aromatic  96 4.20% 95.80% 0.00% 0.00% NA
Intermediate  90 41.10% 55.60% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0811281856 G -> A LOC_Os08g18920.1 upstream_gene_variant ; 2647.0bp to feature; MODIFIER silent_mutation Average:69.23; most accessible tissue: Zhenshan97 panicle, score: 90.268 N N N N
vg0811281856 G -> A LOC_Os08g18930.1 upstream_gene_variant ; 714.0bp to feature; MODIFIER silent_mutation Average:69.23; most accessible tissue: Zhenshan97 panicle, score: 90.268 N N N N
vg0811281856 G -> A LOC_Os08g18920-LOC_Os08g18930 intergenic_region ; MODIFIER silent_mutation Average:69.23; most accessible tissue: Zhenshan97 panicle, score: 90.268 N N N N
vg0811281856 G -> DEL N N silent_mutation Average:69.23; most accessible tissue: Zhenshan97 panicle, score: 90.268 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0811281856 NA 1.09E-07 mr1238 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811281856 NA 1.55E-06 mr1309 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811281856 NA 2.35E-09 mr1379 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811281856 3.63E-06 2.12E-06 mr1401 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811281856 NA 1.97E-08 mr1841 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811281856 5.63E-07 5.63E-07 mr1900 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251