\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0811139003:

Variant ID: vg0811139003 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 11139003
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCTGATTCCGTATGAAAAAAGTTATGTATATACGTGTTTTTTTCTAAAATTTACTCAATGTTTGCGGATATCCGGAAAAAAATTCCGGATAGTTTATGAT[C/T]
GTTTTCCAATTCCGACGGATAGTACCCTTACTGTATTCGTTTTCGTTTCCGAGAAAAAAAATCCAAATTCGCTTCCGAATCCGAGAATTTCCGGATAGTT

Reverse complement sequence

AACTATCCGGAAATTCTCGGATTCGGAAGCGAATTTGGATTTTTTTTCTCGGAAACGAAAACGAATACAGTAAGGGTACTATCCGTCGGAATTGGAAAAC[G/A]
ATCATAAACTATCCGGAATTTTTTTCCGGATATCCGCAAACATTGAGTAAATTTTAGAAAAAAACACGTATATACATAACTTTTTTCATACGGAATCAGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.70% 5.00% 0.93% 3.39% NA
All Indica  2759 99.70% 0.10% 0.04% 0.11% NA
All Japonica  1512 72.60% 14.90% 2.65% 9.79% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.60% 0.20% 0.00% 0.22% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 99.60% 0.00% 0.13% 0.25% NA
Temperate Japonica  767 98.30% 1.20% 0.26% 0.26% NA
Tropical Japonica  504 29.80% 38.70% 5.75% 25.79% NA
Japonica Intermediate  241 80.50% 9.10% 3.73% 6.64% NA
VI/Aromatic  96 93.80% 0.00% 1.04% 5.21% NA
Intermediate  90 87.80% 5.60% 2.22% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0811139003 C -> T LOC_Os08g18170.1 downstream_gene_variant ; 1901.0bp to feature; MODIFIER silent_mutation Average:35.814; most accessible tissue: Zhenshan97 flag leaf, score: 54.545 N N N N
vg0811139003 C -> T LOC_Os08g18150-LOC_Os08g18170 intergenic_region ; MODIFIER silent_mutation Average:35.814; most accessible tissue: Zhenshan97 flag leaf, score: 54.545 N N N N
vg0811139003 C -> DEL N N silent_mutation Average:35.814; most accessible tissue: Zhenshan97 flag leaf, score: 54.545 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0811139003 NA 1.74E-11 mr1016 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811139003 NA 2.63E-11 mr1017 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811139003 NA 2.63E-10 mr1018 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811139003 NA 3.41E-09 mr1019 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811139003 NA 1.07E-07 mr1022 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811139003 NA 3.82E-13 mr1055 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811139003 NA 4.30E-12 mr1132 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811139003 NA 6.52E-06 mr1236 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811139003 NA 1.74E-14 mr1390 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811139003 NA 5.93E-17 mr1490 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811139003 NA 3.33E-09 mr1746 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811139003 NA 3.52E-09 mr1951 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811139003 NA 1.63E-10 mr1019_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811139003 NA 5.72E-16 mr1055_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811139003 NA 7.70E-17 mr1132_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811139003 NA 6.73E-13 mr1178_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811139003 NA 1.43E-17 mr1390_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811139003 NA 6.13E-18 mr1490_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251