\
| Variant ID: vg0811120484 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 11120484 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TAGTACAGGAGTATCCTGAGGTGTTTCCTGAAGACCTCACTACAATGCCACCAAAGAGAGAAATCGAGTTCCAGATTGACCTGGTTAAGGTAACCACTCC[G/A]
ATTTACAAGAGGCCATACAGAATTGCAGCTAATGAGCTAGCAGAGGTCAAGAAGCAAGTTGATGAACAGCTGTAGAAAGGGTACATCCGACCGAGTACTT
AAGTACTCGGTCGGATGTACCCTTTCTACAGCTGTTCATCAACTTGCTTCTTGACCTCTGCTAGCTCATTAGCTGCAATTCTGTATGGCCTCTTGTAAAT[C/T]
GGAGTGGTTACCTTAACCAGGTCAATCTGGAACTCGATTTCTCTCTTTGGTGGCATTGTAGTGAGGTCTTCAGGAAACACCTCAGGATACTCCTGTACTA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 48.10% | 31.10% | 0.38% | 20.40% | NA |
| All Indica | 2759 | 78.70% | 12.40% | 0.40% | 8.45% | NA |
| All Japonica | 1512 | 2.50% | 55.80% | 0.46% | 41.27% | NA |
| Aus | 269 | 7.80% | 91.80% | 0.00% | 0.37% | NA |
| Indica I | 595 | 97.10% | 0.80% | 0.00% | 2.02% | NA |
| Indica II | 465 | 87.10% | 7.70% | 0.22% | 4.95% | NA |
| Indica III | 913 | 64.40% | 20.30% | 0.22% | 15.12% | NA |
| Indica Intermediate | 786 | 76.50% | 14.90% | 1.02% | 7.63% | NA |
| Temperate Japonica | 767 | 2.20% | 87.90% | 0.00% | 9.91% | NA |
| Tropical Japonica | 504 | 2.20% | 14.50% | 1.39% | 81.94% | NA |
| Japonica Intermediate | 241 | 4.10% | 39.80% | 0.00% | 56.02% | NA |
| VI/Aromatic | 96 | 7.30% | 5.20% | 0.00% | 87.50% | NA |
| Intermediate | 90 | 37.80% | 37.80% | 0.00% | 24.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0811120484 | G -> A | LOC_Os08g18130.1 | downstream_gene_variant ; 3122.0bp to feature; MODIFIER | silent_mutation | Average:40.273; most accessible tissue: Zhenshan97 flag leaf, score: 56.01 | N | N | N | N |
| vg0811120484 | G -> A | LOC_Os08g18140.1 | intron_variant ; MODIFIER | silent_mutation | Average:40.273; most accessible tissue: Zhenshan97 flag leaf, score: 56.01 | N | N | N | N |
| vg0811120484 | G -> DEL | N | N | silent_mutation | Average:40.273; most accessible tissue: Zhenshan97 flag leaf, score: 56.01 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0811120484 | NA | 4.90E-07 | mr1206 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811120484 | NA | 2.08E-06 | mr1668 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811120484 | NA | 8.28E-06 | mr1689 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811120484 | 5.79E-06 | NA | mr1089_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811120484 | 3.35E-06 | NA | mr1109_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811120484 | NA | 6.93E-06 | mr1129_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811120484 | NA | 1.28E-12 | mr1241_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811120484 | 6.76E-06 | NA | mr1402_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811120484 | NA | 3.80E-08 | mr1404_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811120484 | 7.05E-06 | NA | mr1423_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811120484 | 9.19E-06 | NA | mr1599_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811120484 | NA | 3.49E-07 | mr1671_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |