Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0811071019:

Variant ID: vg0811071019 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 11071019
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.86, T: 0.14, others allele: 0.00, population size: 81. )

Flanking Sequence (100 bp) in Reference Genome:

TTAGGGAATGCTTAGCCATGCTTAGTTCAACTAGTACACAAAGGGGGATCACATTAATGCATAAACTTTGATTATTGGTATAGCTTTGGATTAGTGCCAC[C/T]
GTAATGGTGTTAGTTAATTAAAGGGACAATTTGAACCATGCCACACAAATTTTACAAAATTTGTGATATGCCACCCTGACCTACATGTCATTGACTCATG

Reverse complement sequence

CATGAGTCAATGACATGTAGGTCAGGGTGGCATATCACAAATTTTGTAAAATTTGTGTGGCATGGTTCAAATTGTCCCTTTAATTAACTAACACCATTAC[G/A]
GTGGCACTAATCCAAAGCTATACCAATAATCAAAGTTTATGCATTAATGTGATCCCCCTTTGTGTACTAGTTGAACTAAGCATGGCTAAGCATTCCCTAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	39.50%	6.20%	10.24%	44.03%	NA
All Indica	2759	12.90%	3.70%	15.73%	67.63%	NA
All Japonica	1512	89.70%	4.00%	0.60%	5.69%	NA
Aus	269	3.30%	46.80%	14.50%	35.32%	NA
Indica I	595	3.90%	0.00%	13.78%	82.35%	NA
Indica II	465	10.10%	0.20%	15.27%	74.41%	NA
Indica III	913	19.80%	9.60%	16.65%	53.89%	NA
Indica Intermediate	786	13.50%	1.70%	16.41%	68.45%	NA
Temperate Japonica	767	87.60%	7.60%	0.39%	4.43%	NA
Tropical Japonica	504	94.00%	0.00%	0.40%	5.56%	NA
Japonica Intermediate	241	87.10%	1.20%	1.66%	9.96%	NA
VI/Aromatic	96	94.80%	2.10%	0.00%	3.12%	NA
Intermediate	90	60.00%	3.30%	2.22%	34.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0811071019	C -> T	LOC_Os08g18070.1	upstream_gene_variant ; 1042.0bp to feature; MODIFIER	silent_mutation	Average:24.365; most accessible tissue: Minghui63 flower, score: 36.491	N	N	N	N
vg0811071019	C -> T	LOC_Os08g18079.1	upstream_gene_variant ; 3035.0bp to feature; MODIFIER	silent_mutation	Average:24.365; most accessible tissue: Minghui63 flower, score: 36.491	N	N	N	N
vg0811071019	C -> T	LOC_Os08g18060.1	downstream_gene_variant ; 4669.0bp to feature; MODIFIER	silent_mutation	Average:24.365; most accessible tissue: Minghui63 flower, score: 36.491	N	N	N	N
vg0811071019	C -> T	LOC_Os08g18070-LOC_Os08g18079	intergenic_region ; MODIFIER	silent_mutation	Average:24.365; most accessible tissue: Minghui63 flower, score: 36.491	N	N	N	N
vg0811071019	C -> DEL	N	N	silent_mutation	Average:24.365; most accessible tissue: Minghui63 flower, score: 36.491	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0811071019	NA	6.10E-07	mr1028	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811071019	4.76E-06	4.76E-06	mr1369	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811071019	NA	3.17E-06	mr1453	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811071019	NA	6.12E-07	mr1648	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811071019	NA	3.31E-06	mr1652	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811071019	NA	5.49E-08	mr1697	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811071019	NA	9.20E-09	mr1510_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811071019	3.50E-06	NA	mr1671_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811071019	NA	3.71E-07	mr1702_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251