Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0811006853:

Variant ID: vg0811006853 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 11006853
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.67, T: 0.33, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:

TTGGTAATTTCAACATCGGAGGTGGAGATAAAACTGAAACGGAATTCAACATGGAAATCGTTCCAAAAACAGAGCAAGGATCGGCTAAAGTCCGAATCAG[T/C]
TGTGACCGGGATCGGTAAAATCCGAGTTGGACAAGGTTAGCCGATTGAGCCGAGTCCGACAATGTGACGCAGTACACGTTGTCAGGTTGAGTTAATTTGC

Reverse complement sequence

GCAAATTAACTCAACCTGACAACGTGTACTGCGTCACATTGTCGGACTCGGCTCAATCGGCTAACCTTGTCCAACTCGGATTTTACCGATCCCGGTCACA[A/G]
CTGATTCGGACTTTAGCCGATCCTTGCTCTGTTTTTGGAACGATTTCCATGTTGAATTCCGTTTCAGTTTTATCTCCACCTCCGATGTTGAAATTACCAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	40.10%	18.60%	27.78%	13.50%	NA
All Indica	2759	37.20%	1.20%	39.98%	21.57%	NA
All Japonica	1512	41.10%	54.60%	3.64%	0.60%	NA
Aus	269	42.00%	0.70%	49.81%	7.43%	NA
Indica I	595	19.20%	1.80%	50.42%	28.57%	NA
Indica II	465	26.70%	1.70%	40.65%	30.97%	NA
Indica III	913	55.40%	0.80%	31.11%	12.71%	NA
Indica Intermediate	786	36.00%	1.00%	41.98%	20.99%	NA
Temperate Japonica	767	4.20%	92.40%	2.61%	0.78%	NA
Tropical Japonica	504	87.30%	8.70%	3.77%	0.20%	NA
Japonica Intermediate	241	62.20%	30.30%	6.64%	0.83%	NA
VI/Aromatic	96	96.90%	0.00%	2.08%	1.04%	NA
Intermediate	90	44.40%	20.00%	21.11%	14.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0811006853	T -> C	LOC_Os08g17940.1	upstream_gene_variant ; 376.0bp to feature; MODIFIER	silent_mutation	Average:10.639; most accessible tissue: Zhenshan97 young leaf, score: 23.373	N	N	N	N
vg0811006853	T -> C	LOC_Os08g17950.1	downstream_gene_variant ; 4115.0bp to feature; MODIFIER	silent_mutation	Average:10.639; most accessible tissue: Zhenshan97 young leaf, score: 23.373	N	N	N	N
vg0811006853	T -> C	LOC_Os08g17940-LOC_Os08g17950	intergenic_region ; MODIFIER	silent_mutation	Average:10.639; most accessible tissue: Zhenshan97 young leaf, score: 23.373	N	N	N	N
vg0811006853	T -> DEL	N	N	silent_mutation	Average:10.639; most accessible tissue: Zhenshan97 young leaf, score: 23.373	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0811006853	NA	2.48E-07	mr1206	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811006853	NA	2.77E-06	mr1309	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811006853	2.08E-06	2.08E-06	mr1464	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811006853	NA	6.52E-06	mr1689	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811006853	NA	1.10E-06	mr1841	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811006853	9.17E-06	9.16E-06	mr1900	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811006853	NA	9.14E-07	mr1404_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811006853	NA	1.27E-08	mr1454_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811006853	NA	4.50E-08	mr1871_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251