\
| Variant ID: vg0810997379 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 10997379 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 245. )
TAATCGATTAGCCGTGCTCACGGTCATGAGCGCTTTGGTGATGTGTCATGAGTATAGACTATGTTTTAAAAATGTGATCATGTGATATTGGTTTGAAATT[A/G]
ATAAATGTGTTGAGTTGTGTGTGTGAGGTGATATATTATGTCTTGTTGTCAAAGGATGACAACAGGAGATTGATTATAATGGAATTATGATGAATTAAAT
ATTTAATTCATCATAATTCCATTATAATCAATCTCCTGTTGTCATCCTTTGACAACAAGACATAATATATCACCTCACACACACAACTCAACACATTTAT[T/C]
AATTTCAAACCAATATCACATGATCACATTTTTAAAACATAGTCTATACTCATGACACATCACCAAAGCGCTCATGACCGTGAGCACGGCTAATCGATTA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 19.00% | 14.20% | 27.63% | 39.17% | NA |
| All Indica | 2759 | 1.70% | 7.70% | 33.09% | 57.56% | NA |
| All Japonica | 1512 | 54.80% | 14.50% | 16.47% | 14.22% | NA |
| Aus | 269 | 0.70% | 63.90% | 30.86% | 4.46% | NA |
| Indica I | 595 | 1.00% | 2.70% | 19.16% | 77.14% | NA |
| Indica II | 465 | 2.40% | 2.20% | 25.81% | 69.68% | NA |
| Indica III | 913 | 1.30% | 13.60% | 43.59% | 41.51% | NA |
| Indica Intermediate | 786 | 2.20% | 7.90% | 35.75% | 54.20% | NA |
| Temperate Japonica | 767 | 92.70% | 1.70% | 3.00% | 2.61% | NA |
| Tropical Japonica | 504 | 8.70% | 31.30% | 33.73% | 26.19% | NA |
| Japonica Intermediate | 241 | 30.70% | 19.90% | 23.24% | 26.14% | NA |
| VI/Aromatic | 96 | 0.00% | 55.20% | 38.54% | 6.25% | NA |
| Intermediate | 90 | 22.20% | 17.80% | 26.67% | 33.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0810997379 | A -> G | LOC_Os08g17920.1 | upstream_gene_variant ; 3549.0bp to feature; MODIFIER | silent_mutation | Average:9.539; most accessible tissue: Callus, score: 17.168 | N | N | N | N |
| vg0810997379 | A -> G | LOC_Os08g17930.1 | upstream_gene_variant ; 964.0bp to feature; MODIFIER | silent_mutation | Average:9.539; most accessible tissue: Callus, score: 17.168 | N | N | N | N |
| vg0810997379 | A -> G | LOC_Os08g17920-LOC_Os08g17930 | intergenic_region ; MODIFIER | silent_mutation | Average:9.539; most accessible tissue: Callus, score: 17.168 | N | N | N | N |
| vg0810997379 | A -> DEL | N | N | silent_mutation | Average:9.539; most accessible tissue: Callus, score: 17.168 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0810997379 | NA | 5.86E-07 | mr1129 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0810997379 | NA | 1.61E-06 | mr1330 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0810997379 | NA | 2.37E-06 | mr1629 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0810997379 | NA | 5.11E-06 | mr1672 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0810997379 | NA | 8.48E-06 | mr1689 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0810997379 | 1.47E-06 | NA | mr1335_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0810997379 | NA | 2.02E-21 | mr1361_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0810997379 | NA | 9.72E-06 | mr1672_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |