Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0810948653:

Variant ID: vg0810948653 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 10948653
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.87, A: 0.13, others allele: 0.00, population size: 84. )

Flanking Sequence (100 bp) in Reference Genome:

TCGGAAACTTGCCAGTTTCCTAATCCCCGTTGAGGCGAGCCCAACTCCACCGCTCAACCACGAAGCCACCGCACGCCCCCTTCGTCAAGGGGTGGGCAAG[G/A]
CGGGAGTCGGCCCACGGAGAGGACTACCAAAGCCTCGATCACTAGGGTAGTTCTTCCTTCACTCCGAAGGTGGTGAACCCCAAACCACTCACAACCGGCG

Reverse complement sequence

CGCCGGTTGTGAGTGGTTTGGGGTTCACCACCTTCGGAGTGAAGGAAGAACTACCCTAGTGATCGAGGCTTTGGTAGTCCTCTCCGTGGGCCGACTCCCG[C/T]
CTTGCCCACCCCTTGACGAAGGGGGCGTGCGGTGGCTTCGTGGTTGAGCGGTGGAGTTGGGCTCGCCTCAACGGGGATTAGGAAACTGGCAAGTTTCCGA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	71.60%	28.10%	0.23%	0.00%	NA
All Indica	2759	88.40%	11.30%	0.29%	0.00%	NA
All Japonica	1512	35.30%	64.70%	0.00%	0.00%	NA
Aus	269	96.70%	3.00%	0.37%	0.00%	NA
Indica I	595	97.10%	2.50%	0.34%	0.00%	NA
Indica II	465	91.40%	8.60%	0.00%	0.00%	NA
Indica III	913	80.40%	19.30%	0.33%	0.00%	NA
Indica Intermediate	786	89.40%	10.20%	0.38%	0.00%	NA
Temperate Japonica	767	7.60%	92.40%	0.00%	0.00%	NA
Tropical Japonica	504	64.30%	35.70%	0.00%	0.00%	NA
Japonica Intermediate	241	62.70%	37.30%	0.00%	0.00%	NA
VI/Aromatic	96	93.80%	6.20%	0.00%	0.00%	NA
Intermediate	90	68.90%	28.90%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0810948653	G -> A	LOC_Os08g17850.1	upstream_gene_variant ; 1465.0bp to feature; MODIFIER	silent_mutation	Average:48.612; most accessible tissue: Minghui63 young leaf, score: 66.656	N	N	N	N
vg0810948653	G -> A	LOC_Os08g17860.1	upstream_gene_variant ; 2944.0bp to feature; MODIFIER	silent_mutation	Average:48.612; most accessible tissue: Minghui63 young leaf, score: 66.656	N	N	N	N
vg0810948653	G -> A	LOC_Os08g17830.1	downstream_gene_variant ; 3520.0bp to feature; MODIFIER	silent_mutation	Average:48.612; most accessible tissue: Minghui63 young leaf, score: 66.656	N	N	N	N
vg0810948653	G -> A	LOC_Os08g17830-LOC_Os08g17850	intergenic_region ; MODIFIER	silent_mutation	Average:48.612; most accessible tissue: Minghui63 young leaf, score: 66.656	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0810948653	NA	4.28E-06	mr1049	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810948653	5.28E-06	NA	mr1289	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810948653	5.95E-06	5.95E-06	mr1358	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810948653	1.89E-06	1.94E-06	mr1401	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810948653	4.49E-06	NA	mr1730	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251