\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0810948653:

Variant ID: vg0810948653 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 10948653
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.87, A: 0.13, others allele: 0.00, population size: 84. )

Flanking Sequence (100 bp) in Reference Genome:


TCGGAAACTTGCCAGTTTCCTAATCCCCGTTGAGGCGAGCCCAACTCCACCGCTCAACCACGAAGCCACCGCACGCCCCCTTCGTCAAGGGGTGGGCAAG[G/A]
CGGGAGTCGGCCCACGGAGAGGACTACCAAAGCCTCGATCACTAGGGTAGTTCTTCCTTCACTCCGAAGGTGGTGAACCCCAAACCACTCACAACCGGCG

Reverse complement sequence

CGCCGGTTGTGAGTGGTTTGGGGTTCACCACCTTCGGAGTGAAGGAAGAACTACCCTAGTGATCGAGGCTTTGGTAGTCCTCTCCGTGGGCCGACTCCCG[C/T]
CTTGCCCACCCCTTGACGAAGGGGGCGTGCGGTGGCTTCGTGGTTGAGCGGTGGAGTTGGGCTCGCCTCAACGGGGATTAGGAAACTGGCAAGTTTCCGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.60% 28.10% 0.23% 0.00% NA
All Indica  2759 88.40% 11.30% 0.29% 0.00% NA
All Japonica  1512 35.30% 64.70% 0.00% 0.00% NA
Aus  269 96.70% 3.00% 0.37% 0.00% NA
Indica I  595 97.10% 2.50% 0.34% 0.00% NA
Indica II  465 91.40% 8.60% 0.00% 0.00% NA
Indica III  913 80.40% 19.30% 0.33% 0.00% NA
Indica Intermediate  786 89.40% 10.20% 0.38% 0.00% NA
Temperate Japonica  767 7.60% 92.40% 0.00% 0.00% NA
Tropical Japonica  504 64.30% 35.70% 0.00% 0.00% NA
Japonica Intermediate  241 62.70% 37.30% 0.00% 0.00% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 68.90% 28.90% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0810948653 G -> A LOC_Os08g17850.1 upstream_gene_variant ; 1465.0bp to feature; MODIFIER silent_mutation Average:48.612; most accessible tissue: Minghui63 young leaf, score: 66.656 N N N N
vg0810948653 G -> A LOC_Os08g17860.1 upstream_gene_variant ; 2944.0bp to feature; MODIFIER silent_mutation Average:48.612; most accessible tissue: Minghui63 young leaf, score: 66.656 N N N N
vg0810948653 G -> A LOC_Os08g17830.1 downstream_gene_variant ; 3520.0bp to feature; MODIFIER silent_mutation Average:48.612; most accessible tissue: Minghui63 young leaf, score: 66.656 N N N N
vg0810948653 G -> A LOC_Os08g17830-LOC_Os08g17850 intergenic_region ; MODIFIER silent_mutation Average:48.612; most accessible tissue: Minghui63 young leaf, score: 66.656 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0810948653 NA 4.28E-06 mr1049 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810948653 5.28E-06 NA mr1289 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810948653 5.95E-06 5.95E-06 mr1358 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810948653 1.89E-06 1.94E-06 mr1401 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810948653 4.49E-06 NA mr1730 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251