Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0810921871:

Variant ID: vg0810921871 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 10921871
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATAGGATTACAAGATAGAAACCTTAACCAACACGGTATCGGTTTCCTAAATCTATTCTACAATGTTACCAAACCAGGACTTTAGGCCGTTCCGTAATATA[T/C]
AAGGAAACGTAATACCCAAGTCATGATCTGTTACATATTCTATAGATATAAGTTATCCCATATAACTAGTCGGATAACCATACCGTGTGGGTATGGGGTA

Reverse complement sequence

TACCCCATACCCACACGGTATGGTTATCCGACTAGTTATATGGGATAACTTATATCTATAGAATATGTAACAGATCATGACTTGGGTATTACGTTTCCTT[A/G]
TATATTACGGAACGGCCTAAAGTCCTGGTTTGGTAACATTGTAGAATAGATTTAGGAAACCGATACCGTGTTGGTTAAGGTTTCTATCTTGTAATCCTAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	70.80%	29.10%	0.02%	0.00%	NA
All Indica	2759	92.80%	7.20%	0.04%	0.00%	NA
All Japonica	1512	40.50%	59.50%	0.00%	0.00%	NA
Aus	269	8.20%	91.80%	0.00%	0.00%	NA
Indica I	595	99.20%	0.80%	0.00%	0.00%	NA
Indica II	465	96.60%	3.40%	0.00%	0.00%	NA
Indica III	913	90.30%	9.70%	0.00%	0.00%	NA
Indica Intermediate	786	88.70%	11.20%	0.13%	0.00%	NA
Temperate Japonica	767	4.80%	95.20%	0.00%	0.00%	NA
Tropical Japonica	504	86.10%	13.90%	0.00%	0.00%	NA
Japonica Intermediate	241	58.50%	41.50%	0.00%	0.00%	NA
VI/Aromatic	96	96.90%	3.10%	0.00%	0.00%	NA
Intermediate	90	67.80%	32.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0810921871	T -> C	LOC_Os08g17810.1	upstream_gene_variant ; 1409.0bp to feature; MODIFIER	silent_mutation	Average:88.132; most accessible tissue: Minghui63 young leaf, score: 95.139	N	N	N	N
vg0810921871	T -> C	LOC_Os08g17820.1	upstream_gene_variant ; 3346.0bp to feature; MODIFIER	silent_mutation	Average:88.132; most accessible tissue: Minghui63 young leaf, score: 95.139	N	N	N	N
vg0810921871	T -> C	LOC_Os08g17820.2	upstream_gene_variant ; 3352.0bp to feature; MODIFIER	silent_mutation	Average:88.132; most accessible tissue: Minghui63 young leaf, score: 95.139	N	N	N	N
vg0810921871	T -> C	LOC_Os08g17800.1	downstream_gene_variant ; 2786.0bp to feature; MODIFIER	silent_mutation	Average:88.132; most accessible tissue: Minghui63 young leaf, score: 95.139	N	N	N	N
vg0810921871	T -> C	LOC_Os08g17810-LOC_Os08g17820	intergenic_region ; MODIFIER	silent_mutation	Average:88.132; most accessible tissue: Minghui63 young leaf, score: 95.139	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0810921871	T	C	-0.01	-0.02	-0.03	-0.04	-0.03	-0.03

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0810921871	NA	1.86E-06	mr1134	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810921871	NA	1.38E-06	mr1689	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810921871	NA	4.38E-08	mr1929	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810921871	7.00E-07	8.21E-08	mr1134_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810921871	NA	5.06E-10	mr1228_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810921871	NA	1.87E-24	mr1401_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810921871	NA	3.22E-06	mr1404_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810921871	NA	3.14E-25	mr1422_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810921871	NA	3.55E-15	mr1583_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810921871	3.32E-07	3.32E-07	mr1670_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810921871	NA	3.55E-07	mr1672_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810921871	NA	4.65E-06	mr1702_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810921871	NA	3.48E-09	mr1769_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810921871	NA	5.74E-15	mr1807_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810921871	NA	1.38E-11	mr1850_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810921871	NA	3.57E-07	mr1885_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810921871	6.61E-06	1.51E-06	mr1951_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810921871	NA	1.75E-11	mr1993_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251