\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0810884968:

Variant ID: vg0810884968 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 10884968
Reference Allele: GAlternative Allele: C
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCCGCCTCCGCGCCAAGGCCGCCACCCTCAGACACTGCCCCCGCCTGCTGCTGACCGTGAGAGAGAGGAAGAGTGAGGAGAGTGAGAGAGAGAAGAGAGA[G/C]
AGGAAGAGAGAGAGGGAGAGTGTATGACAGGTGGGTCCCATATTTTTTAAATATAGAATGCTGACTGGACTGCCACGCGTACGCCACGTAGACCAAAACC

Reverse complement sequence

GGTTTTGGTCTACGTGGCGTACGCGTGGCAGTCCAGTCAGCATTCTATATTTAAAAAATATGGGACCCACCTGTCATACACTCTCCCTCTCTCTCTTCCT[C/G]
TCTCTCTTCTCTCTCTCACTCTCCTCACTCTTCCTCTCTCTCACGGTCAGCAGCAGGCGGGGGCAGTGTCTGAGGGTGGCGGCCTTGGCGCGGAGGCGGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.30% 21.80% 1.78% 14.16% NA
All Indica  2759 91.20% 3.90% 2.75% 2.21% NA
All Japonica  1512 6.90% 59.20% 0.20% 33.73% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 93.90% 0.50% 4.37% 1.18% NA
Indica II  465 87.10% 1.10% 6.67% 5.16% NA
Indica III  913 89.70% 9.30% 0.22% 0.77% NA
Indica Intermediate  786 93.10% 1.80% 2.16% 2.93% NA
Temperate Japonica  767 4.80% 85.30% 0.13% 9.78% NA
Tropical Japonica  504 6.90% 31.00% 0.40% 61.71% NA
Japonica Intermediate  241 13.30% 35.30% 0.00% 51.45% NA
VI/Aromatic  96 10.40% 6.20% 1.04% 82.29% NA
Intermediate  90 51.10% 23.30% 4.44% 21.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0810884968 G -> C LOC_Os08g17760-LOC_Os08g17770 intergenic_region ; MODIFIER silent_mutation Average:74.479; most accessible tissue: Minghui63 panicle, score: 87.951 N N N N
vg0810884968 G -> DEL N N silent_mutation Average:74.479; most accessible tissue: Minghui63 panicle, score: 87.951 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0810884968 G C 0.0 0.01 0.01 0.02 0.02 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0810884968 NA 6.07E-07 mr1708 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810884968 NA 7.81E-09 mr1746 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810884968 NA 9.50E-13 mr1864 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810884968 NA 4.17E-06 mr1555_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251