\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0810881067:

Variant ID: vg0810881067 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 10881067
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGGAACCATGCAAGTATTAGATCATAGATCGTTACCACTCGACGCGCTGCGCAGCGAAAGAAGACGCTGAGAAGTCGAAGGAACTCTCGCGAAGTAGCGC[A/G]
TGTCGATGTAGAGGAAGTAGTCGATCGCACCGGCTCGACCTTCTCCTCTTCGTGTGTTCTCCTCGCTGTACTCCAACGCCGATCAGCACCGCAAACCAGC

Reverse complement sequence

GCTGGTTTGCGGTGCTGATCGGCGTTGGAGTACAGCGAGGAGAACACACGAAGAGGAGAAGGTCGAGCCGGTGCGATCGACTACTTCCTCTACATCGACA[T/C]
GCGCTACTTCGCGAGAGTTCCTTCGACTTCTCAGCGTCTTCTTTCGCTGCGCAGCGCGTCGAGTGGTAACGATCTATGATCTAATACTTGCATGGTTCCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.20% 28.70% 3.09% 0.00% NA
All Indica  2759 98.60% 0.80% 0.62% 0.00% NA
All Japonica  1512 19.30% 80.30% 0.40% 0.00% NA
Aus  269 55.80% 1.10% 43.12% 0.00% NA
Indica I  595 99.30% 0.70% 0.00% 0.00% NA
Indica II  465 96.80% 1.10% 2.15% 0.00% NA
Indica III  913 99.20% 0.50% 0.22% 0.00% NA
Indica Intermediate  786 98.30% 1.00% 0.64% 0.00% NA
Temperate Japonica  767 12.80% 87.10% 0.13% 0.00% NA
Tropical Japonica  504 28.80% 70.60% 0.60% 0.00% NA
Japonica Intermediate  241 20.30% 78.80% 0.83% 0.00% NA
VI/Aromatic  96 13.50% 84.40% 2.08% 0.00% NA
Intermediate  90 53.30% 41.10% 5.56% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0810881067 A -> G LOC_Os08g17760.1 upstream_gene_variant ; 1625.0bp to feature; MODIFIER silent_mutation Average:41.65; most accessible tissue: Zhenshan97 flag leaf, score: 67.31 N N N N
vg0810881067 A -> G LOC_Os08g17760-LOC_Os08g17770 intergenic_region ; MODIFIER silent_mutation Average:41.65; most accessible tissue: Zhenshan97 flag leaf, score: 67.31 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0810881067 NA 1.29E-14 mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810881067 NA 4.22E-18 mr1040_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810881067 NA 4.05E-06 mr1043_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810881067 NA 5.44E-07 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810881067 2.05E-06 NA mr1136_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810881067 6.83E-06 NA mr1137_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810881067 NA 1.42E-06 mr1149_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810881067 NA 7.05E-06 mr1185_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810881067 NA 4.53E-06 mr1204_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810881067 NA 4.79E-07 mr1212_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810881067 NA 2.68E-07 mr1252_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810881067 NA 4.23E-06 mr1269_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810881067 NA 6.26E-08 mr1299_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810881067 NA 8.32E-06 mr1318_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810881067 NA 4.85E-09 mr1379_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810881067 NA 1.21E-23 mr1403_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810881067 8.58E-06 1.07E-07 mr1405_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810881067 NA 3.21E-07 mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810881067 NA 2.21E-06 mr1423_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810881067 NA 8.58E-13 mr1537_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810881067 NA 1.24E-06 mr1559_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810881067 NA 8.49E-18 mr1592_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810881067 1.70E-06 1.70E-06 mr1592_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810881067 NA 1.12E-12 mr1595_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810881067 NA 9.90E-06 mr1595_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810881067 NA 1.22E-10 mr1600_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810881067 NA 6.80E-28 mr1617_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810881067 NA 4.89E-06 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810881067 NA 8.12E-16 mr1713_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810881067 NA 8.09E-06 mr1713_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810881067 NA 3.52E-07 mr1727_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810881067 NA 4.05E-09 mr1741_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810881067 4.71E-06 NA mr1771_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810881067 NA 7.18E-10 mr1783_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810881067 NA 1.44E-07 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810881067 NA 4.20E-06 mr1788_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810881067 NA 6.39E-09 mr1804_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810881067 NA 3.18E-08 mr1837_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810881067 NA 2.95E-06 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810881067 9.70E-06 8.60E-06 mr1888_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810881067 NA 2.14E-14 mr1938_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810881067 NA 3.90E-18 mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251