| Variant ID: vg0810858979 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 10858979 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CAACAGCGGCTCCTAGCAGAACGTATTGACTCACCGGGCATACATAAAGATCATATCGCCTGAATCTCTAGTGTATACTTGTATGAACCCATTTGCCTCA[C/T]
GATATCGATTAAGCTCAAGGCTAGATATGTGCCATCCTCTAATAGCTCAATCATTCACTCGAACCTGTTGGTAGATTATATAACTTGTGATTGACTCCTC
GAGGAGTCAATCACAAGTTATATAATCTACCAACAGGTTCGAGTGAATGATTGAGCTATTAGAGGATGGCACATATCTAGCCTTGAGCTTAATCGATATC[G/A]
TGAGGCAAATGGGTTCATACAAGTATACACTAGAGATTCAGGCGATATGATCTTTATGTATGCCCGGTGAGTCAATACGTTCTGCTAGGAGCCGCTGTTG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 84.40% | 5.80% | 1.82% | 8.00% | NA |
| All Indica | 2759 | 96.80% | 3.00% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 61.40% | 12.00% | 4.70% | 21.89% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 91.70% | 8.00% | 0.33% | 0.00% | NA |
| Indica Intermediate | 786 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 90.90% | 7.70% | 0.13% | 1.30% | NA |
| Tropical Japonica | 504 | 23.60% | 21.00% | 11.71% | 43.65% | NA |
| Japonica Intermediate | 241 | 46.90% | 6.60% | 4.56% | 41.91% | NA |
| VI/Aromatic | 96 | 39.60% | 6.20% | 9.38% | 44.79% | NA |
| Intermediate | 90 | 88.90% | 3.30% | 3.33% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0810858979 | C -> T | LOC_Os08g17750.1 | downstream_gene_variant ; 729.0bp to feature; MODIFIER | silent_mutation | Average:42.014; most accessible tissue: Minghui63 young leaf, score: 56.213 | N | N | N | N |
| vg0810858979 | C -> T | LOC_Os08g17740-LOC_Os08g17750 | intergenic_region ; MODIFIER | silent_mutation | Average:42.014; most accessible tissue: Minghui63 young leaf, score: 56.213 | N | N | N | N |
| vg0810858979 | C -> DEL | N | N | silent_mutation | Average:42.014; most accessible tissue: Minghui63 young leaf, score: 56.213 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0810858979 | 8.43E-07 | 8.43E-07 | mr1915 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0810858979 | NA | 4.15E-06 | mr1045_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0810858979 | 9.16E-06 | 9.16E-06 | mr1541_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |