Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0810856819:

Variant ID: vg0810856819 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 10856819
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.04, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:

ATTATGTTATAAGCTTTGTTTAATGTTAACTTTTTTTCTATATGTAGAATAATTTTTCCCTCTTCTAAAATTATTTAATTGGTCATCTAGTCTAAGGACT[G/A]
TTTGGGTTGATTAGCCAGGCCAAGCCAGTCCTAAGCATGTTTGGGAGGCCAACATGAGATAACCAATGGGATGCAATGAGTCGCTCAAACTCTTCCTTCT

Reverse complement sequence

AGAAGGAAGAGTTTGAGCGACTCATTGCATCCCATTGGTTATCTCATGTTGGCCTCCCAAACATGCTTAGGACTGGCTTGGCCTGGCTAATCAACCCAAA[C/T]
AGTCCTTAGACTAGATGACCAATTAAATAATTTTAGAAGAGGGAAAAATTATTCTACATATAGAAAAAAAGTTAACATTAAACAAAGCTTATAACATAAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.40%	49.40%	0.23%	0.00%	NA
All Indica	2759	18.00%	81.80%	0.25%	0.00%	NA
All Japonica	1512	98.10%	1.90%	0.07%	0.00%	NA
Aus	269	95.90%	3.70%	0.37%	0.00%	NA
Indica I	595	4.40%	95.30%	0.34%	0.00%	NA
Indica II	465	11.20%	88.80%	0.00%	0.00%	NA
Indica III	913	30.40%	69.10%	0.44%	0.00%	NA
Indica Intermediate	786	17.80%	82.10%	0.13%	0.00%	NA
Temperate Japonica	767	98.00%	2.00%	0.00%	0.00%	NA
Tropical Japonica	504	98.80%	1.20%	0.00%	0.00%	NA
Japonica Intermediate	241	96.70%	2.90%	0.41%	0.00%	NA
VI/Aromatic	96	93.80%	5.20%	1.04%	0.00%	NA
Intermediate	90	60.00%	38.90%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0810856819	G -> A	LOC_Os08g17750.1	downstream_gene_variant ; 2889.0bp to feature; MODIFIER	silent_mutation	Average:53.261; most accessible tissue: Callus, score: 79.576	N	N	N	N
vg0810856819	G -> A	LOC_Os08g17740-LOC_Os08g17750	intergenic_region ; MODIFIER	silent_mutation	Average:53.261; most accessible tissue: Callus, score: 79.576	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0810856819	NA	2.67E-07	mr1238	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810856819	NA	1.05E-24	mr1264	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810856819	NA	3.85E-13	mr1270	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810856819	3.41E-06	NA	mr1301	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810856819	NA	5.57E-09	mr1342	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810856819	NA	1.82E-08	mr1457	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810856819	NA	3.29E-11	mr1657	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810856819	NA	1.53E-07	mr1716	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810856819	NA	5.66E-10	mr1720	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810856819	NA	8.97E-24	mr1841	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810856819	NA	1.41E-12	mr1883	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810856819	NA	7.15E-10	mr1945	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810856819	NA	1.98E-13	mr1514_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251