\
| Variant ID: vg0810807387 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 10807387 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 218. )
ATCCAAAAATCTTAGGGTATATATACCTATTTTTTATCCAAAAATCTTGGGTATACGTCTGAATACCCTTGAATACATACTGGGCTCACCCCGAATGAGC[G/A]
TTTGTGGCTATTTTGGATGTATATATCCCTCATATCTACTCCCTCCGTCCCATAAAAAAGAATCTAGGACCGAATGTGATATATTCTAGTACTATGAATC
GATTCATAGTACTAGAATATATCACATTCGGTCCTAGATTCTTTTTTATGGGACGGAGGGAGTAGATATGAGGGATATATACATCCAAAATAGCCACAAA[C/T]
GCTCATTCGGGGTGAGCCCAGTATGTATTCAAGGGTATTCAGACGTATACCCAAGATTTTTGGATAAAAAATAGGTATATATACCCTAAGATTTTTGGAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 54.00% | 45.60% | 0.06% | 0.36% | NA |
| All Indica | 2759 | 23.80% | 75.60% | 0.04% | 0.54% | NA |
| All Japonica | 1512 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Aus | 269 | 95.90% | 3.70% | 0.00% | 0.37% | NA |
| Indica I | 595 | 4.00% | 95.30% | 0.00% | 0.67% | NA |
| Indica II | 465 | 13.80% | 86.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 41.80% | 57.20% | 0.11% | 0.88% | NA |
| Indica Intermediate | 786 | 23.80% | 75.80% | 0.00% | 0.38% | NA |
| Temperate Japonica | 767 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.50% | 2.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 95.80% | 3.10% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 67.80% | 30.00% | 1.11% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0810807387 | G -> A | LOC_Os08g17650.1 | upstream_gene_variant ; 3545.0bp to feature; MODIFIER | silent_mutation | Average:47.875; most accessible tissue: Minghui63 root, score: 81.325 | N | N | N | N |
| vg0810807387 | G -> A | LOC_Os08g17655.1 | downstream_gene_variant ; 2081.0bp to feature; MODIFIER | silent_mutation | Average:47.875; most accessible tissue: Minghui63 root, score: 81.325 | N | N | N | N |
| vg0810807387 | G -> A | LOC_Os08g17680.1 | downstream_gene_variant ; 2924.0bp to feature; MODIFIER | silent_mutation | Average:47.875; most accessible tissue: Minghui63 root, score: 81.325 | N | N | N | N |
| vg0810807387 | G -> A | LOC_Os08g17670.1 | intron_variant ; MODIFIER | silent_mutation | Average:47.875; most accessible tissue: Minghui63 root, score: 81.325 | N | N | N | N |
| vg0810807387 | G -> DEL | N | N | silent_mutation | Average:47.875; most accessible tissue: Minghui63 root, score: 81.325 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0810807387 | NA | 1.87E-11 | mr1609 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0810807387 | NA | 1.44E-11 | mr1883 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0810807387 | NA | 8.67E-10 | mr1945 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0810807387 | 1.13E-06 | NA | mr1499_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0810807387 | NA | 1.78E-11 | mr1728_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0810807387 | NA | 1.28E-11 | mr1850_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |