Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0810755455:

Variant ID: vg0810755455 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 10755455
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AGTTCTTCTCCCAAGCCTAAATTAATTAATAAATGGCCTCAAGAAATTATCTGTGTAATGGCAAGAGAGAAACCCTAATTTAATAAATGCAAATAATAAT[C/T]
GGAAATGGCATGTGGAATTTTTCTTGGGTTTTATATGTCAAAATATGCCAACAGAAATTTAGTGGAATTTTCAGAGCTCTAGAAATAATTTTAACTAAAT

Reverse complement sequence

ATTTAGTTAAAATTATTTCTAGAGCTCTGAAAATTCCACTAAATTTCTGTTGGCATATTTTGACATATAAAACCCAAGAAAAATTCCACATGCCATTTCC[G/A]
ATTATTATTTGCATTTATTAAATTAGGGTTTCTCTCTTGCCATTACACAGATAATTTCTTGAGGCCATTTATTAATTAATTTAGGCTTGGGAGAAGAACT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	97.20%	2.80%	0.00%	0.00%	NA
All Indica	2759	95.50%	4.50%	0.00%	0.00%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	97.60%	2.40%	0.00%	0.00%	NA
Indica III	913	92.70%	7.30%	0.00%	0.00%	NA
Indica Intermediate	786	94.30%	5.70%	0.00%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	95.60%	4.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0810755455	C -> T	LOC_Os08g17580.1	upstream_gene_variant ; 642.0bp to feature; MODIFIER	silent_mutation	Average:32.711; most accessible tissue: Callus, score: 51.039	N	N	N	N
vg0810755455	C -> T	LOC_Os08g17600.1	upstream_gene_variant ; 4138.0bp to feature; MODIFIER	silent_mutation	Average:32.711; most accessible tissue: Callus, score: 51.039	N	N	N	N
vg0810755455	C -> T	LOC_Os08g17600.2	upstream_gene_variant ; 4183.0bp to feature; MODIFIER	silent_mutation	Average:32.711; most accessible tissue: Callus, score: 51.039	N	N	N	N
vg0810755455	C -> T	LOC_Os08g17580-LOC_Os08g17600	intergenic_region ; MODIFIER	silent_mutation	Average:32.711; most accessible tissue: Callus, score: 51.039	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0810755455	NA	5.82E-06	mr1063	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810755455	1.02E-06	4.20E-10	mr1134	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810755455	NA	7.45E-07	mr1135	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810755455	NA	2.36E-08	mr1504	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810755455	NA	8.07E-06	mr1672	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810755455	NA	4.35E-07	mr1134_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810755455	8.37E-06	6.13E-08	mr1672_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810755455	NA	2.93E-08	mr1769_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251