\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0810755455:

Variant ID: vg0810755455 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 10755455
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGTTCTTCTCCCAAGCCTAAATTAATTAATAAATGGCCTCAAGAAATTATCTGTGTAATGGCAAGAGAGAAACCCTAATTTAATAAATGCAAATAATAAT[C/T]
GGAAATGGCATGTGGAATTTTTCTTGGGTTTTATATGTCAAAATATGCCAACAGAAATTTAGTGGAATTTTCAGAGCTCTAGAAATAATTTTAACTAAAT

Reverse complement sequence

ATTTAGTTAAAATTATTTCTAGAGCTCTGAAAATTCCACTAAATTTCTGTTGGCATATTTTGACATATAAAACCCAAGAAAAATTCCACATGCCATTTCC[G/A]
ATTATTATTTGCATTTATTAAATTAGGGTTTCTCTCTTGCCATTACACAGATAATTTCTTGAGGCCATTTATTAATTAATTTAGGCTTGGGAGAAGAACT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.20% 2.80% 0.00% 0.00% NA
All Indica  2759 95.50% 4.50% 0.00% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 97.60% 2.40% 0.00% 0.00% NA
Indica III  913 92.70% 7.30% 0.00% 0.00% NA
Indica Intermediate  786 94.30% 5.70% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 95.60% 4.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0810755455 C -> T LOC_Os08g17580.1 upstream_gene_variant ; 642.0bp to feature; MODIFIER silent_mutation Average:32.711; most accessible tissue: Callus, score: 51.039 N N N N
vg0810755455 C -> T LOC_Os08g17600.1 upstream_gene_variant ; 4138.0bp to feature; MODIFIER silent_mutation Average:32.711; most accessible tissue: Callus, score: 51.039 N N N N
vg0810755455 C -> T LOC_Os08g17600.2 upstream_gene_variant ; 4183.0bp to feature; MODIFIER silent_mutation Average:32.711; most accessible tissue: Callus, score: 51.039 N N N N
vg0810755455 C -> T LOC_Os08g17580-LOC_Os08g17600 intergenic_region ; MODIFIER silent_mutation Average:32.711; most accessible tissue: Callus, score: 51.039 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0810755455 NA 5.82E-06 mr1063 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810755455 1.02E-06 4.20E-10 mr1134 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810755455 NA 7.45E-07 mr1135 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810755455 NA 2.36E-08 mr1504 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810755455 NA 8.07E-06 mr1672 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810755455 NA 4.35E-07 mr1134_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810755455 8.37E-06 6.13E-08 mr1672_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810755455 NA 2.93E-08 mr1769_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251