\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0810737306:

Variant ID: vg0810737306 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 10737306
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAAGTGCGCGTGATCCAGTGCCCAATACCTTAAAATCCTTTTATACCGCAATTACTCAACTTTTTAGGAGTTGGTACAATGCATCTTAAAAGGTGTCAAA[C/T]
AGTAAAGCTTTATATAGCTGCCCCGCTGACTTTTTTATATAAGTCAAGGTGATGTTTGAGTTTTTAAGCAATTGATTGGATACAATATCGTTGCTTTTTG

Reverse complement sequence

CAAAAAGCAACGATATTGTATCCAATCAATTGCTTAAAAACTCAAACATCACCTTGACTTATATAAAAAAGTCAGCGGGGCAGCTATATAAAGCTTTACT[G/A]
TTTGACACCTTTTAAGATGCATTGTACCAACTCCTAAAAAGTTGAGTAATTGCGGTATAAAAGGATTTTAAGGTATTGGGCACTGGATCACGCGCACTTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.20% 2.10% 0.23% 2.41% NA
All Indica  2759 99.70% 0.20% 0.04% 0.04% NA
All Japonica  1512 86.20% 6.20% 0.60% 7.01% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.00% 0.00% 0.22% NA
Indica III  913 99.60% 0.40% 0.00% 0.00% NA
Indica Intermediate  786 99.70% 0.10% 0.13% 0.00% NA
Temperate Japonica  767 92.30% 7.40% 0.00% 0.26% NA
Tropical Japonica  504 73.60% 6.30% 1.79% 18.25% NA
Japonica Intermediate  241 93.40% 1.70% 0.00% 4.98% NA
VI/Aromatic  96 94.80% 0.00% 1.04% 4.17% NA
Intermediate  90 93.30% 3.30% 0.00% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0810737306 C -> T LOC_Os08g17550.1 downstream_gene_variant ; 1986.0bp to feature; MODIFIER silent_mutation Average:33.803; most accessible tissue: Zhenshan97 flag leaf, score: 50.663 N N N N
vg0810737306 C -> T LOC_Os08g17540-LOC_Os08g17550 intergenic_region ; MODIFIER silent_mutation Average:33.803; most accessible tissue: Zhenshan97 flag leaf, score: 50.663 N N N N
vg0810737306 C -> DEL N N silent_mutation Average:33.803; most accessible tissue: Zhenshan97 flag leaf, score: 50.663 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0810737306 NA 4.94E-08 mr1028 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810737306 4.40E-06 4.40E-06 mr1369 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810737306 NA 3.44E-07 mr1453 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810737306 NA 8.36E-08 mr1648 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810737306 NA 4.13E-07 mr1652 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810737306 4.56E-08 2.69E-11 mr1697 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810737306 NA 8.60E-06 mr1458_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251