\
| Variant ID: vg0810737306 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 10737306 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AAAGTGCGCGTGATCCAGTGCCCAATACCTTAAAATCCTTTTATACCGCAATTACTCAACTTTTTAGGAGTTGGTACAATGCATCTTAAAAGGTGTCAAA[C/T]
AGTAAAGCTTTATATAGCTGCCCCGCTGACTTTTTTATATAAGTCAAGGTGATGTTTGAGTTTTTAAGCAATTGATTGGATACAATATCGTTGCTTTTTG
CAAAAAGCAACGATATTGTATCCAATCAATTGCTTAAAAACTCAAACATCACCTTGACTTATATAAAAAAGTCAGCGGGGCAGCTATATAAAGCTTTACT[G/A]
TTTGACACCTTTTAAGATGCATTGTACCAACTCCTAAAAAGTTGAGTAATTGCGGTATAAAAGGATTTTAAGGTATTGGGCACTGGATCACGCGCACTTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.20% | 2.10% | 0.23% | 2.41% | NA |
| All Indica | 2759 | 99.70% | 0.20% | 0.04% | 0.04% | NA |
| All Japonica | 1512 | 86.20% | 6.20% | 0.60% | 7.01% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.00% | 0.00% | 0.22% | NA |
| Indica III | 913 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.70% | 0.10% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 92.30% | 7.40% | 0.00% | 0.26% | NA |
| Tropical Japonica | 504 | 73.60% | 6.30% | 1.79% | 18.25% | NA |
| Japonica Intermediate | 241 | 93.40% | 1.70% | 0.00% | 4.98% | NA |
| VI/Aromatic | 96 | 94.80% | 0.00% | 1.04% | 4.17% | NA |
| Intermediate | 90 | 93.30% | 3.30% | 0.00% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0810737306 | C -> T | LOC_Os08g17550.1 | downstream_gene_variant ; 1986.0bp to feature; MODIFIER | silent_mutation | Average:33.803; most accessible tissue: Zhenshan97 flag leaf, score: 50.663 | N | N | N | N |
| vg0810737306 | C -> T | LOC_Os08g17540-LOC_Os08g17550 | intergenic_region ; MODIFIER | silent_mutation | Average:33.803; most accessible tissue: Zhenshan97 flag leaf, score: 50.663 | N | N | N | N |
| vg0810737306 | C -> DEL | N | N | silent_mutation | Average:33.803; most accessible tissue: Zhenshan97 flag leaf, score: 50.663 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0810737306 | NA | 4.94E-08 | mr1028 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0810737306 | 4.40E-06 | 4.40E-06 | mr1369 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0810737306 | NA | 3.44E-07 | mr1453 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0810737306 | NA | 8.36E-08 | mr1648 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0810737306 | NA | 4.13E-07 | mr1652 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0810737306 | 4.56E-08 | 2.69E-11 | mr1697 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0810737306 | NA | 8.60E-06 | mr1458_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |