\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0810686573:

Variant ID: vg0810686573 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 10686573
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.06, others allele: 0.00, population size: 36. )

Flanking Sequence (100 bp) in Reference Genome:


TGGTGACTCATCATGCTGATAAGTGGACCCGTACATATGCCTCATCTATCTATTATCTATCTATCTATCTATCTATTATATACTAAAAGTCCATTAAACT[C/T]
CCTATAAACGCTCTCAAGCTGCCATGTGGCTCCCTCAAAACGCTCTCATATTGCCACGTGGCACTCTAATATAATAGAGAAATCTGACCATCAATTTTCA

Reverse complement sequence

TGAAAATTGATGGTCAGATTTCTCTATTATATTAGAGTGCCACGTGGCAATATGAGAGCGTTTTGAGGGAGCCACATGGCAGCTTGAGAGCGTTTATAGG[G/A]
AGTTTAATGGACTTTTAGTATATAATAGATAGATAGATAGATAGATAATAGATAGATGAGGCATATGTACGGGTCCACTTATCAGCATGATGAGTCACCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 18.70% 15.90% 14.11% 51.33% NA
All Indica  2759 2.90% 21.80% 18.99% 56.29% NA
All Japonica  1512 51.50% 0.70% 2.98% 44.91% NA
Aus  269 2.60% 44.60% 23.79% 29.00% NA
Indica I  595 4.90% 15.80% 18.99% 60.34% NA
Indica II  465 1.70% 28.00% 16.34% 53.98% NA
Indica III  913 2.60% 22.80% 22.12% 52.46% NA
Indica Intermediate  786 2.40% 21.60% 16.92% 59.03% NA
Temperate Japonica  767 85.50% 0.50% 0.91% 13.04% NA
Tropical Japonica  504 10.10% 0.60% 4.76% 84.52% NA
Japonica Intermediate  241 29.50% 1.20% 5.81% 63.49% NA
VI/Aromatic  96 0.00% 10.40% 14.58% 75.00% NA
Intermediate  90 18.90% 10.00% 22.22% 48.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0810686573 C -> T LOC_Os08g17440.1 upstream_gene_variant ; 467.0bp to feature; MODIFIER silent_mutation Average:59.039; most accessible tissue: Callus, score: 91.188 N N N N
vg0810686573 C -> T LOC_Os08g17430.1 downstream_gene_variant ; 4647.0bp to feature; MODIFIER silent_mutation Average:59.039; most accessible tissue: Callus, score: 91.188 N N N N
vg0810686573 C -> T LOC_Os08g17440-LOC_Os08g17450 intergenic_region ; MODIFIER silent_mutation Average:59.039; most accessible tissue: Callus, score: 91.188 N N N N
vg0810686573 C -> DEL N N silent_mutation Average:59.039; most accessible tissue: Callus, score: 91.188 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0810686573 NA 4.91E-08 mr1043_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810686573 NA 3.61E-07 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810686573 NA 1.34E-06 mr1072_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810686573 NA 4.80E-06 mr1075_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810686573 NA 2.94E-07 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810686573 NA 5.10E-06 mr1149_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810686573 NA 4.74E-07 mr1185_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810686573 NA 7.11E-06 mr1204_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810686573 NA 4.96E-07 mr1248_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810686573 NA 2.64E-07 mr1250_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810686573 NA 8.30E-09 mr1251_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810686573 NA 1.68E-07 mr1252_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810686573 NA 9.28E-09 mr1252_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810686573 NA 1.59E-06 mr1255_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810686573 NA 1.84E-06 mr1263_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810686573 NA 1.06E-07 mr1269_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810686573 NA 5.82E-07 mr1405_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810686573 NA 1.29E-06 mr1423_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810686573 NA 9.47E-09 mr1435_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810686573 NA 1.02E-06 mr1479_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810686573 NA 2.27E-07 mr1482_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810686573 NA 2.56E-06 mr1555_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810686573 6.99E-06 6.99E-06 mr1592_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810686573 8.34E-06 8.34E-06 mr1608_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810686573 NA 9.03E-06 mr1646_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810686573 NA 1.29E-06 mr1677_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810686573 NA 3.54E-06 mr1693_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810686573 NA 2.19E-07 mr1693_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810686573 NA 9.47E-09 mr1741_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810686573 NA 4.82E-06 mr1741_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810686573 NA 2.95E-06 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810686573 NA 2.02E-15 mr1800_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810686573 NA 2.64E-08 mr1800_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810686573 NA 7.19E-11 mr1844_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810686573 NA 7.37E-06 mr1844_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810686573 NA 9.91E-06 mr1912_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251