Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0810686573:

Variant ID: vg0810686573 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 10686573
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.06, others allele: 0.00, population size: 36. )

Flanking Sequence (100 bp) in Reference Genome:

TGGTGACTCATCATGCTGATAAGTGGACCCGTACATATGCCTCATCTATCTATTATCTATCTATCTATCTATCTATTATATACTAAAAGTCCATTAAACT[C/T]
CCTATAAACGCTCTCAAGCTGCCATGTGGCTCCCTCAAAACGCTCTCATATTGCCACGTGGCACTCTAATATAATAGAGAAATCTGACCATCAATTTTCA

Reverse complement sequence

TGAAAATTGATGGTCAGATTTCTCTATTATATTAGAGTGCCACGTGGCAATATGAGAGCGTTTTGAGGGAGCCACATGGCAGCTTGAGAGCGTTTATAGG[G/A]
AGTTTAATGGACTTTTAGTATATAATAGATAGATAGATAGATAGATAATAGATAGATGAGGCATATGTACGGGTCCACTTATCAGCATGATGAGTCACCA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	18.70%	15.90%	14.11%	51.33%	NA
All Indica	2759	2.90%	21.80%	18.99%	56.29%	NA
All Japonica	1512	51.50%	0.70%	2.98%	44.91%	NA
Aus	269	2.60%	44.60%	23.79%	29.00%	NA
Indica I	595	4.90%	15.80%	18.99%	60.34%	NA
Indica II	465	1.70%	28.00%	16.34%	53.98%	NA
Indica III	913	2.60%	22.80%	22.12%	52.46%	NA
Indica Intermediate	786	2.40%	21.60%	16.92%	59.03%	NA
Temperate Japonica	767	85.50%	0.50%	0.91%	13.04%	NA
Tropical Japonica	504	10.10%	0.60%	4.76%	84.52%	NA
Japonica Intermediate	241	29.50%	1.20%	5.81%	63.49%	NA
VI/Aromatic	96	0.00%	10.40%	14.58%	75.00%	NA
Intermediate	90	18.90%	10.00%	22.22%	48.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0810686573	C -> T	LOC_Os08g17440.1	upstream_gene_variant ; 467.0bp to feature; MODIFIER	silent_mutation	Average:59.039; most accessible tissue: Callus, score: 91.188	N	N	N	N
vg0810686573	C -> T	LOC_Os08g17430.1	downstream_gene_variant ; 4647.0bp to feature; MODIFIER	silent_mutation	Average:59.039; most accessible tissue: Callus, score: 91.188	N	N	N	N
vg0810686573	C -> T	LOC_Os08g17440-LOC_Os08g17450	intergenic_region ; MODIFIER	silent_mutation	Average:59.039; most accessible tissue: Callus, score: 91.188	N	N	N	N
vg0810686573	C -> DEL	N	N	silent_mutation	Average:59.039; most accessible tissue: Callus, score: 91.188	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0810686573	NA	4.91E-08	mr1043_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810686573	NA	3.61E-07	mr1045_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810686573	NA	1.34E-06	mr1072_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810686573	NA	4.80E-06	mr1075_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810686573	NA	2.94E-07	mr1077_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810686573	NA	5.10E-06	mr1149_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810686573	NA	4.74E-07	mr1185_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810686573	NA	7.11E-06	mr1204_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810686573	NA	4.96E-07	mr1248_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810686573	NA	2.64E-07	mr1250_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810686573	NA	8.30E-09	mr1251_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810686573	NA	1.68E-07	mr1252_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810686573	NA	9.28E-09	mr1252_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810686573	NA	1.59E-06	mr1255_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810686573	NA	1.84E-06	mr1263_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810686573	NA	1.06E-07	mr1269_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810686573	NA	5.82E-07	mr1405_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810686573	NA	1.29E-06	mr1423_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810686573	NA	9.47E-09	mr1435_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810686573	NA	1.02E-06	mr1479_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810686573	NA	2.27E-07	mr1482_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810686573	NA	2.56E-06	mr1555_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810686573	6.99E-06	6.99E-06	mr1592_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810686573	8.34E-06	8.34E-06	mr1608_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810686573	NA	9.03E-06	mr1646_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810686573	NA	1.29E-06	mr1677_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810686573	NA	3.54E-06	mr1693_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810686573	NA	2.19E-07	mr1693_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810686573	NA	9.47E-09	mr1741_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810686573	NA	4.82E-06	mr1741_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810686573	NA	2.95E-06	mr1785_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810686573	NA	2.02E-15	mr1800_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810686573	NA	2.64E-08	mr1800_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810686573	NA	7.19E-11	mr1844_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810686573	NA	7.37E-06	mr1844_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810686573	NA	9.91E-06	mr1912_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251