Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0810682226:

Variant ID: vg0810682226 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 10682226
Reference Allele: T	Alternative Allele: G,A
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGCCGCCGCCCATCGCCCTTCCCCGCGCTGCGCCATGCGTGTCGGCCGCCGGCGTGCGCGCCGCTGCCGCTGACCGTCGTGACCGACGAAGAGAGAGAAA[T/G,A]
AAAGAGATAGGGGAAGAGAGAAATGGGTCTGACATGTGGGTCCCACCATTAAGAATAAAATAAAATGCTGACTGGAGTGCCACGTGTATGCCACGTAGGC

Reverse complement sequence

GCCTACGTGGCATACACGTGGCACTCCAGTCAGCATTTTATTTTATTCTTAATGGTGGGACCCACATGTCAGACCCATTTCTCTCTTCCCCTATCTCTTT[A/C,T]
TTTCTCTCTCTTCGTCGGTCACGACGGTCAGCGGCAGCGGCGCGCACGCCGGCGGCCGACACGCATGGCGCAGCGCGGGGAAGGGCGATGGGCGGCGGCA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	88.70%	10.90%	0.44%	0.00%	A: 0.02%
All Indica	2759	92.60%	6.70%	0.65%	0.00%	A: 0.04%
All Japonica	1512	87.60%	12.30%	0.13%	0.00%	NA
Aus	269	52.80%	47.20%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	92.70%	4.50%	2.58%	0.00%	A: 0.22%
Indica III	913	91.10%	8.70%	0.22%	0.00%	NA
Indica Intermediate	786	88.50%	10.90%	0.51%	0.00%	NA
Temperate Japonica	767	92.40%	7.60%	0.00%	0.00%	NA
Tropical Japonica	504	78.00%	21.80%	0.20%	0.00%	NA
Japonica Intermediate	241	92.10%	7.50%	0.41%	0.00%	NA
VI/Aromatic	96	93.80%	6.20%	0.00%	0.00%	NA
Intermediate	90	90.00%	8.90%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0810682226	T -> G	LOC_Os08g17430.1	downstream_gene_variant ; 300.0bp to feature; MODIFIER	silent_mutation	Average:76.03; most accessible tissue: Callus, score: 91.634	N	N	N	N
vg0810682226	T -> G	LOC_Os08g17440.1	downstream_gene_variant ; 3138.0bp to feature; MODIFIER	silent_mutation	Average:76.03; most accessible tissue: Callus, score: 91.634	N	N	N	N
vg0810682226	T -> G	LOC_Os08g17430-LOC_Os08g17440	intergenic_region ; MODIFIER	silent_mutation	Average:76.03; most accessible tissue: Callus, score: 91.634	N	N	N	N
vg0810682226	T -> A	LOC_Os08g17430.1	downstream_gene_variant ; 300.0bp to feature; MODIFIER	silent_mutation	Average:76.03; most accessible tissue: Callus, score: 91.634	N	N	N	N
vg0810682226	T -> A	LOC_Os08g17440.1	downstream_gene_variant ; 3138.0bp to feature; MODIFIER	silent_mutation	Average:76.03; most accessible tissue: Callus, score: 91.634	N	N	N	N
vg0810682226	T -> A	LOC_Os08g17430-LOC_Os08g17440	intergenic_region ; MODIFIER	silent_mutation	Average:76.03; most accessible tissue: Callus, score: 91.634	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0810682226	2.22E-06	NA	mr1040_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810682226	6.71E-07	1.56E-07	mr1040_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810682226	NA	1.01E-06	mr1043_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810682226	NA	7.81E-07	mr1045_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810682226	4.70E-06	4.70E-06	mr1054_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810682226	NA	4.37E-06	mr1077_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810682226	3.50E-06	9.86E-06	mr1085_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810682226	8.08E-06	8.08E-06	mr1145_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810682226	2.01E-06	1.02E-07	mr1155_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810682226	NA	2.64E-06	mr1185_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810682226	NA	1.85E-06	mr1239_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810682226	NA	2.19E-06	mr1252_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810682226	NA	7.72E-06	mr1255_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810682226	NA	1.08E-06	mr1269_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810682226	2.86E-06	2.86E-06	mr1285_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810682226	NA	4.10E-06	mr1291_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810682226	1.93E-06	1.93E-06	mr1356_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810682226	2.90E-06	1.71E-06	mr1362_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810682226	1.59E-06	1.59E-06	mr1372_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810682226	6.72E-06	1.16E-06	mr1405_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810682226	5.48E-06	7.87E-08	mr1405_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810682226	NA	3.11E-06	mr1458_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810682226	NA	7.21E-06	mr1482_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810682226	6.44E-06	6.44E-06	mr1573_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810682226	5.57E-06	5.57E-06	mr1592_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810682226	NA	8.46E-06	mr1638_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810682226	NA	2.90E-06	mr1677_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810682226	NA	2.39E-06	mr1704_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810682226	NA	8.13E-06	mr1713_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810682226	NA	1.34E-06	mr1718_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810682226	NA	6.32E-07	mr1736_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810682226	NA	1.53E-07	mr1740_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810682226	NA	3.71E-06	mr1741_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810682226	4.40E-06	NA	mr1757_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810682226	4.35E-06	4.35E-06	mr1785_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251