\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0810682226:

Variant ID: vg0810682226 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 10682226
Reference Allele: TAlternative Allele: G,A
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGCCGCCGCCCATCGCCCTTCCCCGCGCTGCGCCATGCGTGTCGGCCGCCGGCGTGCGCGCCGCTGCCGCTGACCGTCGTGACCGACGAAGAGAGAGAAA[T/G,A]
AAAGAGATAGGGGAAGAGAGAAATGGGTCTGACATGTGGGTCCCACCATTAAGAATAAAATAAAATGCTGACTGGAGTGCCACGTGTATGCCACGTAGGC

Reverse complement sequence

GCCTACGTGGCATACACGTGGCACTCCAGTCAGCATTTTATTTTATTCTTAATGGTGGGACCCACATGTCAGACCCATTTCTCTCTTCCCCTATCTCTTT[A/C,T]
TTTCTCTCTCTTCGTCGGTCACGACGGTCAGCGGCAGCGGCGCGCACGCCGGCGGCCGACACGCATGGCGCAGCGCGGGGAAGGGCGATGGGCGGCGGCA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.70% 10.90% 0.44% 0.00% A: 0.02%
All Indica  2759 92.60% 6.70% 0.65% 0.00% A: 0.04%
All Japonica  1512 87.60% 12.30% 0.13% 0.00% NA
Aus  269 52.80% 47.20% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 92.70% 4.50% 2.58% 0.00% A: 0.22%
Indica III  913 91.10% 8.70% 0.22% 0.00% NA
Indica Intermediate  786 88.50% 10.90% 0.51% 0.00% NA
Temperate Japonica  767 92.40% 7.60% 0.00% 0.00% NA
Tropical Japonica  504 78.00% 21.80% 0.20% 0.00% NA
Japonica Intermediate  241 92.10% 7.50% 0.41% 0.00% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 90.00% 8.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0810682226 T -> G LOC_Os08g17430.1 downstream_gene_variant ; 300.0bp to feature; MODIFIER silent_mutation Average:76.03; most accessible tissue: Callus, score: 91.634 N N N N
vg0810682226 T -> G LOC_Os08g17440.1 downstream_gene_variant ; 3138.0bp to feature; MODIFIER silent_mutation Average:76.03; most accessible tissue: Callus, score: 91.634 N N N N
vg0810682226 T -> G LOC_Os08g17430-LOC_Os08g17440 intergenic_region ; MODIFIER silent_mutation Average:76.03; most accessible tissue: Callus, score: 91.634 N N N N
vg0810682226 T -> A LOC_Os08g17430.1 downstream_gene_variant ; 300.0bp to feature; MODIFIER silent_mutation Average:76.03; most accessible tissue: Callus, score: 91.634 N N N N
vg0810682226 T -> A LOC_Os08g17440.1 downstream_gene_variant ; 3138.0bp to feature; MODIFIER silent_mutation Average:76.03; most accessible tissue: Callus, score: 91.634 N N N N
vg0810682226 T -> A LOC_Os08g17430-LOC_Os08g17440 intergenic_region ; MODIFIER silent_mutation Average:76.03; most accessible tissue: Callus, score: 91.634 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0810682226 2.22E-06 NA mr1040_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810682226 6.71E-07 1.56E-07 mr1040_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810682226 NA 1.01E-06 mr1043_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810682226 NA 7.81E-07 mr1045_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810682226 4.70E-06 4.70E-06 mr1054_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810682226 NA 4.37E-06 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810682226 3.50E-06 9.86E-06 mr1085_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810682226 8.08E-06 8.08E-06 mr1145_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810682226 2.01E-06 1.02E-07 mr1155_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810682226 NA 2.64E-06 mr1185_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810682226 NA 1.85E-06 mr1239_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810682226 NA 2.19E-06 mr1252_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810682226 NA 7.72E-06 mr1255_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810682226 NA 1.08E-06 mr1269_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810682226 2.86E-06 2.86E-06 mr1285_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810682226 NA 4.10E-06 mr1291_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810682226 1.93E-06 1.93E-06 mr1356_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810682226 2.90E-06 1.71E-06 mr1362_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810682226 1.59E-06 1.59E-06 mr1372_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810682226 6.72E-06 1.16E-06 mr1405_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810682226 5.48E-06 7.87E-08 mr1405_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810682226 NA 3.11E-06 mr1458_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810682226 NA 7.21E-06 mr1482_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810682226 6.44E-06 6.44E-06 mr1573_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810682226 5.57E-06 5.57E-06 mr1592_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810682226 NA 8.46E-06 mr1638_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810682226 NA 2.90E-06 mr1677_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810682226 NA 2.39E-06 mr1704_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810682226 NA 8.13E-06 mr1713_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810682226 NA 1.34E-06 mr1718_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810682226 NA 6.32E-07 mr1736_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810682226 NA 1.53E-07 mr1740_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810682226 NA 3.71E-06 mr1741_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810682226 4.40E-06 NA mr1757_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810682226 4.35E-06 4.35E-06 mr1785_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251