\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0810668699:

Variant ID: vg0810668699 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 10668699
Reference Allele: CAlternative Allele: G,T
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.66, G: 0.34, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:


AATTATGGAGACGCTTTTTAAAGCGTACCTATATTATTTAAGACGTTGCTAGAGACGTATAAATTGCATCTCTACAAAATATAGAGACGCTTTTATATAG[C/G,T]
CACGCACATCTTAATATATTTGATATTAATGCTTTCATCTGGGCTCGAACACAGCACCTGCAGGTTGCAAAGTTCATGCACTAACCAAGTCATTAACGTG

Reverse complement sequence

CACGTTAATGACTTGGTTAGTGCATGAACTTTGCAACCTGCAGGTGCTGTGTTCGAGCCCAGATGAAAGCATTAATATCAAATATATTAAGATGTGCGTG[G/C,A]
CTATATAAAAGCGTCTCTATATTTTGTAGAGATGCAATTTATACGTCTCTAGCAACGTCTTAAATAATATAGGTACGCTTTAAAAAGCGTCTCCATAATT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.00% 9.50% 0.63% 5.80% T: 0.02%
All Indica  2759 89.40% 4.30% 0.62% 5.65% T: 0.04%
All Japonica  1512 87.90% 11.80% 0.07% 0.20% NA
Aus  269 3.70% 50.60% 3.72% 42.01% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 92.90% 3.40% 0.43% 3.23% NA
Indica III  913 82.30% 9.20% 1.31% 7.23% NA
Indica Intermediate  786 87.50% 2.40% 0.38% 9.54% T: 0.13%
Temperate Japonica  767 92.40% 7.30% 0.00% 0.26% NA
Tropical Japonica  504 78.80% 21.00% 0.20% 0.00% NA
Japonica Intermediate  241 92.50% 7.10% 0.00% 0.41% NA
VI/Aromatic  96 91.70% 8.30% 0.00% 0.00% NA
Intermediate  90 86.70% 8.90% 2.22% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0810668699 C -> G LOC_Os08g17420.1 upstream_gene_variant ; 4106.0bp to feature; MODIFIER silent_mutation Average:35.199; most accessible tissue: Minghui63 root, score: 57.225 N N N N
vg0810668699 C -> G LOC_Os08g17410-LOC_Os08g17420 intergenic_region ; MODIFIER silent_mutation Average:35.199; most accessible tissue: Minghui63 root, score: 57.225 N N N N
vg0810668699 C -> T LOC_Os08g17420.1 upstream_gene_variant ; 4106.0bp to feature; MODIFIER silent_mutation Average:35.199; most accessible tissue: Minghui63 root, score: 57.225 N N N N
vg0810668699 C -> T LOC_Os08g17410-LOC_Os08g17420 intergenic_region ; MODIFIER silent_mutation Average:35.199; most accessible tissue: Minghui63 root, score: 57.225 N N N N
vg0810668699 C -> DEL N N silent_mutation Average:35.199; most accessible tissue: Minghui63 root, score: 57.225 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0810668699 5.26E-06 NA mr1040_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810668699 NA 9.74E-06 mr1043_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810668699 NA 1.79E-06 mr1045_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810668699 4.45E-06 NA mr1085_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810668699 NA 6.30E-06 mr1134_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810668699 NA 4.61E-09 mr1136_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810668699 NA 8.41E-06 mr1149_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810668699 NA 8.58E-06 mr1185_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810668699 NA 9.97E-06 mr1200_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810668699 NA 5.37E-06 mr1204_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810668699 NA 8.02E-06 mr1263_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810668699 NA 6.20E-06 mr1405_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810668699 NA 3.18E-06 mr1405_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810668699 NA 4.46E-06 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810668699 NA 3.40E-06 mr1638_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810668699 6.01E-06 5.80E-08 mr1672_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810668699 NA 2.75E-06 mr1677_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810668699 NA 2.17E-08 mr1702_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810668699 NA 8.37E-06 mr1713_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810668699 NA 1.35E-08 mr1729_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810668699 NA 1.37E-07 mr1740_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251