Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0810559229:

Variant ID: vg0810559229 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 10559229
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.00, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:

CATGGTTATGAAAAATAATAATAATCAAGTTATGCTCTCACAAGCTTGAGCATGATGTTAAAAAAATGTAGCCATGCCCTCTCCTAATCAATAAAAGAAG[G/A]
ATTTTTGGGAGAAGAAAGTAAGCAATAAGGAGAAGCAATTTCTTTATTTTTTCTCATGTACCACTTTCATCATATACCACACACACATTGCACGATCTTG

Reverse complement sequence

CAAGATCGTGCAATGTGTGTGTGGTATATGATGAAAGTGGTACATGAGAAAAAATAAAGAAATTGCTTCTCCTTATTGCTTACTTTCTTCTCCCAAAAAT[C/T]
CTTCTTTTATTGATTAGGAGAGGGCATGGCTACATTTTTTTAACATCATGCTCAAGCTTGTGAGAGCATAACTTGATTATTATTATTTTTCATAACCATG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	83.20%	14.90%	1.59%	0.23%	NA
All Indica	2759	96.20%	3.60%	0.11%	0.04%	NA
All Japonica	1512	66.60%	33.30%	0.13%	0.00%	NA
Aus	269	72.10%	0.00%	24.16%	3.72%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.60%	0.40%	0.00%	0.00%	NA
Indica III	913	90.10%	9.60%	0.11%	0.11%	NA
Indica Intermediate	786	98.50%	1.30%	0.25%	0.00%	NA
Temperate Japonica	767	90.70%	9.30%	0.00%	0.00%	NA
Tropical Japonica	504	38.50%	61.30%	0.20%	0.00%	NA
Japonica Intermediate	241	48.50%	51.00%	0.41%	0.00%	NA
VI/Aromatic	96	12.50%	85.40%	2.08%	0.00%	NA
Intermediate	90	73.30%	23.30%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0810559229	G -> A	LOC_Os08g17240.1	downstream_gene_variant ; 2711.0bp to feature; MODIFIER	silent_mutation	Average:29.684; most accessible tissue: Minghui63 young leaf, score: 42.042	N	N	N	N
vg0810559229	G -> A	LOC_Os08g17250.1	downstream_gene_variant ; 870.0bp to feature; MODIFIER	silent_mutation	Average:29.684; most accessible tissue: Minghui63 young leaf, score: 42.042	N	N	N	N
vg0810559229	G -> A	LOC_Os08g17259.1	downstream_gene_variant ; 2143.0bp to feature; MODIFIER	silent_mutation	Average:29.684; most accessible tissue: Minghui63 young leaf, score: 42.042	N	N	N	N
vg0810559229	G -> A	LOC_Os08g17270.1	downstream_gene_variant ; 4935.0bp to feature; MODIFIER	silent_mutation	Average:29.684; most accessible tissue: Minghui63 young leaf, score: 42.042	N	N	N	N
vg0810559229	G -> A	LOC_Os08g17250-LOC_Os08g17259	intergenic_region ; MODIFIER	silent_mutation	Average:29.684; most accessible tissue: Minghui63 young leaf, score: 42.042	N	N	N	N
vg0810559229	G -> DEL	N	N	silent_mutation	Average:29.684; most accessible tissue: Minghui63 young leaf, score: 42.042	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0810559229	NA	3.93E-06	mr1045	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810559229	9.17E-06	2.58E-16	mr1084	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810559229	NA	9.27E-07	mr1084	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810559229	NA	8.29E-06	mr1095	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810559229	NA	9.63E-08	mr1184	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810559229	NA	9.75E-16	mr1205	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810559229	NA	4.90E-06	mr1205	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810559229	NA	3.19E-09	mr1206	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810559229	NA	2.84E-07	mr1206	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810559229	NA	9.34E-06	mr1215	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810559229	NA	6.55E-07	mr1229	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810559229	NA	6.02E-06	mr1263	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810559229	NA	2.44E-09	mr1332	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810559229	NA	1.66E-06	mr1374	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810559229	NA	2.44E-06	mr1383	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810559229	NA	2.21E-06	mr1405	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810559229	6.94E-06	6.96E-06	mr1430	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810559229	NA	6.02E-06	mr1451	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810559229	NA	5.55E-13	mr1454	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810559229	NA	5.47E-08	mr1506	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810559229	NA	7.01E-06	mr1508	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810559229	NA	1.30E-14	mr1521	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810559229	NA	5.21E-06	mr1521	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810559229	NA	2.33E-07	mr1596	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810559229	NA	3.55E-08	mr1668	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810559229	NA	3.70E-07	mr1668	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810559229	NA	2.87E-06	mr1671	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810559229	NA	1.27E-07	mr1680	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810559229	NA	2.52E-06	mr1729	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810559229	NA	8.00E-06	mr1763	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810559229	NA	1.36E-12	mr1775	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810559229	NA	8.11E-06	mr1775	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810559229	NA	3.34E-07	mr1810	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810559229	NA	1.04E-07	mr1824	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810559229	NA	5.44E-06	mr1832	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810559229	NA	6.27E-10	mr1851	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810559229	NA	1.25E-06	mr1851	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810559229	NA	4.57E-15	mr1864	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810559229	NA	6.45E-10	mr1864	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810559229	NA	9.78E-08	mr1671_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251