Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0810545060:

Variant ID: vg0810545060 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 10545060
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:

AGCCATGCATCTTTCTCCGCCTTGTTGGAAGTCCGCTTCTTGTACTGCCACGCGTAGTATGGAAATCCATACTTCCAGGGAACAGAAGACCCAACGCCTC[G/A]
TGTCCGTCCACGGTGTTCCTTGTTGCCCAACACTTTCGTGAGGAGGTCGTCCTCGCGTCTTTGAGAGCAGGCCTCTTGCGAGGGTTGTTGCTCGGCAACC

Reverse complement sequence

GGTTGCCGAGCAACAACCCTCGCAAGAGGCCTGCTCTCAAAGACGCGAGGACGACCTCCTCACGAAAGTGTTGGGCAACAAGGAACACCGTGGACGGACA[C/T]
GAGGCGTTGGGTCTTCTGTTCCCTGGAAGTATGGATTTCCATACTACGCGTGGCAGTACAAGAAGCGGACTTCCAACAAGGCGGAGAAAGATGCATGGCT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	82.50%	14.80%	0.32%	2.39%	NA
All Indica	2759	96.40%	3.40%	0.04%	0.11%	NA
All Japonica	1512	59.20%	33.20%	0.86%	6.75%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.40%	0.40%	0.00%	0.22%	NA
Indica III	913	90.80%	9.10%	0.11%	0.00%	NA
Indica Intermediate	786	98.50%	1.30%	0.00%	0.25%	NA
Temperate Japonica	767	90.90%	8.90%	0.00%	0.26%	NA
Tropical Japonica	504	18.10%	61.70%	2.18%	18.06%	NA
Japonica Intermediate	241	44.40%	51.00%	0.83%	3.73%	NA
VI/Aromatic	96	11.50%	83.30%	1.04%	4.17%	NA
Intermediate	90	72.20%	23.30%	0.00%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0810545060	G -> A	LOC_Os08g17210.1	stop_gained ; p.Arg280*; HIGH	stop_gained	Average:45.087; most accessible tissue: Minghui63 flag leaf, score: 62.47	N	N	N	N
vg0810545060	G -> DEL	LOC_Os08g17210.1	N	frameshift_variant	Average:45.087; most accessible tissue: Minghui63 flag leaf, score: 62.47	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0810545060	NA	3.08E-06	mr1045	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810545060	NA	4.24E-15	mr1084	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810545060	NA	1.67E-07	mr1184	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810545060	NA	2.84E-14	mr1205	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810545060	NA	6.18E-09	mr1206	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810545060	NA	1.23E-06	mr1229	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810545060	NA	7.08E-06	mr1280	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810545060	NA	2.50E-12	mr1330	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810545060	NA	3.10E-09	mr1332	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810545060	NA	2.53E-06	mr1374	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810545060	NA	6.63E-07	mr1405	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810545060	NA	6.75E-14	mr1454	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810545060	NA	1.62E-08	mr1506	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810545060	NA	8.66E-06	mr1507	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810545060	NA	4.80E-15	mr1521	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810545060	NA	4.91E-06	mr1521	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810545060	NA	6.52E-08	mr1596	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810545060	NA	2.77E-09	mr1668	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810545060	NA	4.48E-07	mr1668	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810545060	NA	5.47E-08	mr1680	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810545060	NA	3.28E-07	mr1729	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810545060	NA	9.25E-08	mr1746	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810545060	NA	1.82E-12	mr1775	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810545060	NA	2.05E-07	mr1824	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810545060	NA	2.68E-11	mr1851	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810545060	NA	1.17E-06	mr1851	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810545060	NA	5.66E-06	mr1863	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810545060	NA	1.03E-16	mr1864	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810545060	NA	9.97E-10	mr1864	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810545060	NA	2.16E-08	mr1671_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251