\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0810507145:

Variant ID: vg0810507145 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 10507145
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.82, G: 0.19, others allele: 0.00, population size: 186. )

Flanking Sequence (100 bp) in Reference Genome:


CAGCTCCAACTCCATCTCTTCTAAAGTTGGAAGTCCAAACAAAAAGTTTTAGCTCCAACAATAAAAAAAAATAGAGTGGACTAAAGTGCTCTCACAAAAT[A/G]
AACTCAAGAGGTGAAGCTTGATTTAGAAAGACTTAATTTTTAGAGTTAGAACTCTATCAAACATGTCTTAATTGTTCAGGATCACATAGGTTGACGTGAC

Reverse complement sequence

GTCACGTCAACCTATGTGATCCTGAACAATTAAGACATGTTTGATAGAGTTCTAACTCTAAAAATTAAGTCTTTCTAAATCAAGCTTCACCTCTTGAGTT[T/C]
ATTTTGTGAGAGCACTTTAGTCCACTCTATTTTTTTTTATTGTTGGAGCTAAAACTTTTTGTTTGGACTTCCAACTTTAGAAGAGATGGAGTTGGAGCTG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.60% 22.00% 0.36% 0.00% NA
All Indica  2759 81.20% 18.30% 0.54% 0.00% NA
All Japonica  1512 83.50% 16.50% 0.07% 0.00% NA
Aus  269 1.90% 98.10% 0.00% 0.00% NA
Indica I  595 95.80% 3.90% 0.34% 0.00% NA
Indica II  465 87.70% 12.00% 0.22% 0.00% NA
Indica III  913 69.70% 29.50% 0.88% 0.00% NA
Indica Intermediate  786 79.50% 20.00% 0.51% 0.00% NA
Temperate Japonica  767 90.40% 9.60% 0.00% 0.00% NA
Tropical Japonica  504 73.20% 26.80% 0.00% 0.00% NA
Japonica Intermediate  241 83.00% 16.60% 0.41% 0.00% NA
VI/Aromatic  96 91.70% 8.30% 0.00% 0.00% NA
Intermediate  90 82.20% 16.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0810507145 A -> G LOC_Os08g17160.1 upstream_gene_variant ; 979.0bp to feature; MODIFIER silent_mutation Average:85.914; most accessible tissue: Minghui63 panicle, score: 94.394 N N N N
vg0810507145 A -> G LOC_Os08g17150.1 downstream_gene_variant ; 2872.0bp to feature; MODIFIER silent_mutation Average:85.914; most accessible tissue: Minghui63 panicle, score: 94.394 N N N N
vg0810507145 A -> G LOC_Os08g17150-LOC_Os08g17160 intergenic_region ; MODIFIER silent_mutation Average:85.914; most accessible tissue: Minghui63 panicle, score: 94.394 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0810507145 A G -0.01 -0.01 0.0 0.01 0.0 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0810507145 NA 5.93E-06 mr1787 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810507145 NA 4.02E-06 mr1952 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810507145 NA 3.11E-06 mr1072_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810507145 NA 5.80E-07 mr1075_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810507145 NA 5.85E-07 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810507145 NA 1.06E-07 mr1149_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810507145 NA 1.71E-06 mr1204_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810507145 NA 8.39E-08 mr1252_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810507145 NA 5.16E-06 mr1318_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810507145 NA 7.97E-07 mr1405_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810507145 NA 8.49E-07 mr1441_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810507145 NA 3.74E-09 mr1510_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810507145 1.73E-06 1.73E-06 mr1592_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810507145 NA 2.82E-06 mr1595_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810507145 NA 9.14E-06 mr1600_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810507145 NA 4.14E-06 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810507145 NA 4.39E-06 mr1693_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810507145 NA 2.31E-06 mr1729_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810507145 NA 2.27E-06 mr1740_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810507145 NA 2.00E-06 mr1788_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810507145 NA 5.53E-07 mr1792_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810507145 4.30E-06 4.30E-06 mr1985_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251