\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0810358913:

Variant ID: vg0810358913 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 10358913
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.61, C: 0.39, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:


ACGAATTTAAAAACTGACTCAAATACGGATTTGTATTTCTAAAATCAAACGGATTTAAGAACCGACTCATACGCGGATGACGTACTGACAAAAACATTTT[T/C]
AATTTTTATAATAGTAGAGATAGAGATATAATAGTAAAGATAAAGATATATGTGCGCAGTAGCTTGATTGAATATTTCTCTGATTAGGTTTTTGTATTTC

Reverse complement sequence

GAAATACAAAAACCTAATCAGAGAAATATTCAATCAAGCTACTGCGCACATATATCTTTATCTTTACTATTATATCTCTATCTCTACTATTATAAAAATT[A/G]
AAAATGTTTTTGTCAGTACGTCATCCGCGTATGAGTCGGTTCTTAAATCCGTTTGATTTTAGAAATACAAATCCGTATTTGAGTCAGTTTTTAAATTCGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.20% 19.10% 1.71% 0.97% NA
All Indica  2759 93.40% 2.10% 2.86% 1.67% NA
All Japonica  1512 45.40% 54.60% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 81.50% 4.20% 8.40% 5.88% NA
Indica II  465 93.50% 3.70% 2.37% 0.43% NA
Indica III  913 98.90% 0.20% 0.66% 0.22% NA
Indica Intermediate  786 95.80% 1.80% 1.53% 0.89% NA
Temperate Japonica  767 7.20% 92.70% 0.13% 0.00% NA
Tropical Japonica  504 91.30% 8.70% 0.00% 0.00% NA
Japonica Intermediate  241 71.00% 29.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 76.70% 22.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0810358913 T -> C LOC_Os08g16910.1 upstream_gene_variant ; 538.0bp to feature; MODIFIER silent_mutation Average:66.27; most accessible tissue: Minghui63 flower, score: 79.679 N N N N
vg0810358913 T -> C LOC_Os08g16914.1 downstream_gene_variant ; 1496.0bp to feature; MODIFIER silent_mutation Average:66.27; most accessible tissue: Minghui63 flower, score: 79.679 N N N N
vg0810358913 T -> C LOC_Os08g16914.2 downstream_gene_variant ; 1496.0bp to feature; MODIFIER silent_mutation Average:66.27; most accessible tissue: Minghui63 flower, score: 79.679 N N N N
vg0810358913 T -> C LOC_Os08g16910-LOC_Os08g16914 intergenic_region ; MODIFIER silent_mutation Average:66.27; most accessible tissue: Minghui63 flower, score: 79.679 N N N N
vg0810358913 T -> DEL N N silent_mutation Average:66.27; most accessible tissue: Minghui63 flower, score: 79.679 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0810358913 1.08E-06 4.06E-06 mr1174 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810358913 NA 1.60E-06 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810358913 NA 3.09E-12 mr1741 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251