\
| Variant ID: vg0810358913 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 10358913 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.61, C: 0.39, others allele: 0.00, population size: 97. )
ACGAATTTAAAAACTGACTCAAATACGGATTTGTATTTCTAAAATCAAACGGATTTAAGAACCGACTCATACGCGGATGACGTACTGACAAAAACATTTT[T/C]
AATTTTTATAATAGTAGAGATAGAGATATAATAGTAAAGATAAAGATATATGTGCGCAGTAGCTTGATTGAATATTTCTCTGATTAGGTTTTTGTATTTC
GAAATACAAAAACCTAATCAGAGAAATATTCAATCAAGCTACTGCGCACATATATCTTTATCTTTACTATTATATCTCTATCTCTACTATTATAAAAATT[A/G]
AAAATGTTTTTGTCAGTACGTCATCCGCGTATGAGTCGGTTCTTAAATCCGTTTGATTTTAGAAATACAAATCCGTATTTGAGTCAGTTTTTAAATTCGT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 78.20% | 19.10% | 1.71% | 0.97% | NA |
| All Indica | 2759 | 93.40% | 2.10% | 2.86% | 1.67% | NA |
| All Japonica | 1512 | 45.40% | 54.60% | 0.07% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 81.50% | 4.20% | 8.40% | 5.88% | NA |
| Indica II | 465 | 93.50% | 3.70% | 2.37% | 0.43% | NA |
| Indica III | 913 | 98.90% | 0.20% | 0.66% | 0.22% | NA |
| Indica Intermediate | 786 | 95.80% | 1.80% | 1.53% | 0.89% | NA |
| Temperate Japonica | 767 | 7.20% | 92.70% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 91.30% | 8.70% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 71.00% | 29.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 76.70% | 22.20% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0810358913 | T -> C | LOC_Os08g16910.1 | upstream_gene_variant ; 538.0bp to feature; MODIFIER | silent_mutation | Average:66.27; most accessible tissue: Minghui63 flower, score: 79.679 | N | N | N | N |
| vg0810358913 | T -> C | LOC_Os08g16914.1 | downstream_gene_variant ; 1496.0bp to feature; MODIFIER | silent_mutation | Average:66.27; most accessible tissue: Minghui63 flower, score: 79.679 | N | N | N | N |
| vg0810358913 | T -> C | LOC_Os08g16914.2 | downstream_gene_variant ; 1496.0bp to feature; MODIFIER | silent_mutation | Average:66.27; most accessible tissue: Minghui63 flower, score: 79.679 | N | N | N | N |
| vg0810358913 | T -> C | LOC_Os08g16910-LOC_Os08g16914 | intergenic_region ; MODIFIER | silent_mutation | Average:66.27; most accessible tissue: Minghui63 flower, score: 79.679 | N | N | N | N |
| vg0810358913 | T -> DEL | N | N | silent_mutation | Average:66.27; most accessible tissue: Minghui63 flower, score: 79.679 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0810358913 | 1.08E-06 | 4.06E-06 | mr1174 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0810358913 | NA | 1.60E-06 | mr1330 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0810358913 | NA | 3.09E-12 | mr1741 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |