Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0810358913:

Variant ID: vg0810358913 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 10358913
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.61, C: 0.39, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:

ACGAATTTAAAAACTGACTCAAATACGGATTTGTATTTCTAAAATCAAACGGATTTAAGAACCGACTCATACGCGGATGACGTACTGACAAAAACATTTT[T/C]
AATTTTTATAATAGTAGAGATAGAGATATAATAGTAAAGATAAAGATATATGTGCGCAGTAGCTTGATTGAATATTTCTCTGATTAGGTTTTTGTATTTC

Reverse complement sequence

GAAATACAAAAACCTAATCAGAGAAATATTCAATCAAGCTACTGCGCACATATATCTTTATCTTTACTATTATATCTCTATCTCTACTATTATAAAAATT[A/G]
AAAATGTTTTTGTCAGTACGTCATCCGCGTATGAGTCGGTTCTTAAATCCGTTTGATTTTAGAAATACAAATCCGTATTTGAGTCAGTTTTTAAATTCGT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	78.20%	19.10%	1.71%	0.97%	NA
All Indica	2759	93.40%	2.10%	2.86%	1.67%	NA
All Japonica	1512	45.40%	54.60%	0.07%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	81.50%	4.20%	8.40%	5.88%	NA
Indica II	465	93.50%	3.70%	2.37%	0.43%	NA
Indica III	913	98.90%	0.20%	0.66%	0.22%	NA
Indica Intermediate	786	95.80%	1.80%	1.53%	0.89%	NA
Temperate Japonica	767	7.20%	92.70%	0.13%	0.00%	NA
Tropical Japonica	504	91.30%	8.70%	0.00%	0.00%	NA
Japonica Intermediate	241	71.00%	29.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	76.70%	22.20%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0810358913	T -> C	LOC_Os08g16910.1	upstream_gene_variant ; 538.0bp to feature; MODIFIER	silent_mutation	Average:66.27; most accessible tissue: Minghui63 flower, score: 79.679	N	N	N	N
vg0810358913	T -> C	LOC_Os08g16914.1	downstream_gene_variant ; 1496.0bp to feature; MODIFIER	silent_mutation	Average:66.27; most accessible tissue: Minghui63 flower, score: 79.679	N	N	N	N
vg0810358913	T -> C	LOC_Os08g16914.2	downstream_gene_variant ; 1496.0bp to feature; MODIFIER	silent_mutation	Average:66.27; most accessible tissue: Minghui63 flower, score: 79.679	N	N	N	N
vg0810358913	T -> C	LOC_Os08g16910-LOC_Os08g16914	intergenic_region ; MODIFIER	silent_mutation	Average:66.27; most accessible tissue: Minghui63 flower, score: 79.679	N	N	N	N
vg0810358913	T -> DEL	N	N	silent_mutation	Average:66.27; most accessible tissue: Minghui63 flower, score: 79.679	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0810358913	1.08E-06	4.06E-06	mr1174	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810358913	NA	1.60E-06	mr1330	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810358913	NA	3.09E-12	mr1741	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251