\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0810288130:

Variant ID: vg0810288130 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 10288130
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACATTATGAAACGGAGGGAGTAGCTACTAAAATAAGCTACTTGACACGTTAGCAAGAGGTACAATGTTTTTTATTGAGAATTTCGATACTCCCTTCATTT[C/T]
AGGTTATAAGATGTTTTGATTTTGGTTAAAATTAAACTGATTCAAGTTTAACTAAATTTATAGACAAATATAGTAATATTTGCATTATCAAATTAGTTTT

Reverse complement sequence

AAAACTAATTTGATAATGCAAATATTACTATATTTGTCTATAAATTTAGTTAAACTTGAATCAGTTTAATTTTAACCAAAATCAAAACATCTTATAACCT[G/A]
AAATGAAGGGAGTATCGAAATTCTCAATAAAAAACATTGTACCTCTTGCTAACGTGTCAAGTAGCTTATTTTAGTAGCTACTCCCTCCGTTTCATAATGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.90% 8.10% 0.02% 0.00% NA
All Indica  2759 96.30% 3.60% 0.04% 0.00% NA
All Japonica  1512 87.60% 12.40% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 90.50% 9.40% 0.11% 0.00% NA
Indica Intermediate  786 98.50% 1.50% 0.00% 0.00% NA
Temperate Japonica  767 92.30% 7.70% 0.00% 0.00% NA
Tropical Japonica  504 77.40% 22.60% 0.00% 0.00% NA
Japonica Intermediate  241 94.20% 5.80% 0.00% 0.00% NA
VI/Aromatic  96 12.50% 87.50% 0.00% 0.00% NA
Intermediate  90 85.60% 14.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0810288130 C -> T LOC_Os08g16800.1 upstream_gene_variant ; 2795.0bp to feature; MODIFIER silent_mutation Average:48.164; most accessible tissue: Minghui63 root, score: 79.954 N N N N
vg0810288130 C -> T LOC_Os08g16810.1 upstream_gene_variant ; 288.0bp to feature; MODIFIER silent_mutation Average:48.164; most accessible tissue: Minghui63 root, score: 79.954 N N N N
vg0810288130 C -> T LOC_Os08g16820.1 downstream_gene_variant ; 3911.0bp to feature; MODIFIER silent_mutation Average:48.164; most accessible tissue: Minghui63 root, score: 79.954 N N N N
vg0810288130 C -> T LOC_Os08g16810-LOC_Os08g16820 intergenic_region ; MODIFIER silent_mutation Average:48.164; most accessible tissue: Minghui63 root, score: 79.954 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0810288130 NA 5.81E-11 mr1070 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810288130 NA 6.98E-06 mr1940 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810288130 NA 9.98E-07 mr1045_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810288130 7.01E-06 NA mr1083_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810288130 4.15E-07 NA mr1085_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810288130 1.69E-06 8.67E-06 mr1085_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810288130 5.59E-06 NA mr1104_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810288130 1.15E-06 NA mr1107_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810288130 9.51E-06 NA mr1155_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810288130 NA 2.95E-06 mr1204_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810288130 NA 3.12E-06 mr1252_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810288130 5.08E-06 NA mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810288130 NA 5.77E-06 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810288130 3.71E-06 NA mr1771_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810288130 NA 9.83E-06 mr1788_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251