\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0810206019:

Variant ID: vg0810206019 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 10206019
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.81, T: 0.19, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:


AGCCTTACGATCCCTTTTCTTCTCATCGTTGGACCAATCCTGTGTCCTCTTGTCAAATCCAGAAAGCGCATCATCGAGGTCTTGTTGTGCAAGAACGGCT[C/T]
GCATCTTCACTTGCCAAAGTGAGAATCTTGTGTCTCGATCCAGGAGCGGTAGATCATACTTCAAACTCGCCATGGGAATTAATCCTGAAATTTGCTAGAA

Reverse complement sequence

TTCTAGCAAATTTCAGGATTAATTCCCATGGCGAGTTTGAAGTATGATCTACCGCTCCTGGATCGAGACACAAGATTCTCACTTTGGCAAGTGAAGATGC[G/A]
AGCCGTTCTTGCACAACAAGACCTCGATGATGCGCTTTCTGGATTTGACAAGAGGACACAGGATTGGTCCAACGATGAGAAGAAAAGGGATCGTAAGGCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.20% 43.60% 2.75% 1.50% NA
All Indica  2759 32.10% 61.40% 4.02% 2.43% NA
All Japonica  1512 93.80% 6.10% 0.13% 0.00% NA
Aus  269 5.20% 88.10% 5.58% 1.12% NA
Indica I  595 10.90% 82.40% 4.20% 2.52% NA
Indica II  465 53.50% 44.50% 1.29% 0.65% NA
Indica III  913 38.40% 53.30% 5.04% 3.18% NA
Indica Intermediate  786 28.10% 65.00% 4.33% 2.54% NA
Temperate Japonica  767 95.30% 4.70% 0.00% 0.00% NA
Tropical Japonica  504 94.00% 5.80% 0.20% 0.00% NA
Japonica Intermediate  241 88.40% 11.20% 0.41% 0.00% NA
VI/Aromatic  96 93.80% 5.20% 1.04% 0.00% NA
Intermediate  90 64.40% 33.30% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0810206019 C -> T LOC_Os08g16680.1 missense_variant ; p.Arg25Gln; MODERATE nonsynonymous_codon ; R25Q Average:59.704; most accessible tissue: Zhenshan97 flower, score: 93.211 benign 0.107 TOLERATED 0.15
vg0810206019 C -> DEL LOC_Os08g16680.1 N frameshift_variant Average:59.704; most accessible tissue: Zhenshan97 flower, score: 93.211 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0810206019 C T -0.01 -0.01 -0.02 -0.03 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0810206019 NA 8.25E-06 mr1075 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810206019 NA 1.91E-08 mr1510 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810206019 NA 5.15E-06 mr1641 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810206019 3.80E-06 1.62E-06 mr1767 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810206019 NA 2.08E-06 mr1839 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810206019 NA 9.10E-06 mr1909 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810206019 NA 6.12E-06 mr1921 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251