\
| Variant ID: vg0810149802 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 10149802 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.00, others allele: 0.00, population size: 263. )
ACGGATGGAGTGTTACCTTCCCATGATGTCATTACCTGCCTTGTCATTGTTGTAGCCGTACTGGTAAGTGGGCATTGCGCTTAGAAATTTCCATGGCTCC[G/A]
ATGCACACGGATCCCATTGGATGATTGCATGCTGCTTCTTGCCTGCAGGCAGGGGCGGATCCAAGGGGTAGGCTTCATCAGGCTCAAGTTTGCCTTCCGA
TCGGAAGGCAAACTTGAGCCTGATGAAGCCTACCCCTTGGATCCGCCCCTGCCTGCAGGCAAGAAGCAGCATGCAATCATCCAATGGGATCCGTGTGCAT[C/T]
GGAGCCATGGAAATTTCTAAGCGCAATGCCCACTTACCAGTACGGCTACAACAATGACAAGGCAGGTAATGACATCATGGGAAGGTAACACTCCATCCGT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.70% | 6.30% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 87.30% | 12.70% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 92.60% | 7.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 77.40% | 22.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 91.30% | 8.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 10.40% | 88.50% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 85.60% | 14.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0810149802 | G -> A | LOC_Os08g16590.1 | upstream_gene_variant ; 26.0bp to feature; MODIFIER | silent_mutation | Average:49.029; most accessible tissue: Callus, score: 68.779 | N | N | N | N |
| vg0810149802 | G -> A | LOC_Os08g16600.1 | upstream_gene_variant ; 2269.0bp to feature; MODIFIER | silent_mutation | Average:49.029; most accessible tissue: Callus, score: 68.779 | N | N | N | N |
| vg0810149802 | G -> A | LOC_Os08g16590-LOC_Os08g16600 | intergenic_region ; MODIFIER | silent_mutation | Average:49.029; most accessible tissue: Callus, score: 68.779 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0810149802 | NA | 7.51E-11 | mr1070 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0810149802 | NA | 1.03E-06 | mr1940 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0810149802 | NA | 2.08E-06 | mr1045_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0810149802 | 2.40E-06 | NA | mr1085_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0810149802 | 4.69E-06 | NA | mr1107_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0810149802 | NA | 5.47E-06 | mr1204_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0810149802 | NA | 3.56E-06 | mr1252_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0810149802 | NA | 8.43E-06 | mr1617_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0810149802 | 4.63E-06 | NA | mr1771_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0810149802 | NA | 4.88E-06 | mr1788_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |