\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0810145390:

Variant ID: vg0810145390 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 10145390
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.86, G: 0.14, others allele: 0.00, population size: 72. )

Flanking Sequence (100 bp) in Reference Genome:


TAATTGTGTAGTATATGTTTATAGGTGATTATTATATGAATTAGCTATTAAATTGACCATAGATGATTTGAAGCCAACAGTTTGCTATACTACTCCCTCC[A/G]
TTTCATAATGTAAGACTTTCTAGCATTGCTCATATTCATATACTCTCTCCATTTCAAAATATAAGTCATTTTAGCATTTCTTATATTCATATATATCTAG

Reverse complement sequence

CTAGATATATATGAATATAAGAAATGCTAAAATGACTTATATTTTGAAATGGAGAGAGTATATGAATATGAGCAATGCTAGAAAGTCTTACATTATGAAA[T/C]
GGAGGGAGTAGTATAGCAAACTGTTGGCTTCAAATCATCTATGGTCAATTTAATAGCTAATTCATATAATAATCACCTATAAACATATACTACACAATTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.30% 12.70% 0.00% 0.00% NA
All Indica  2759 98.40% 1.60% 0.00% 0.00% NA
All Japonica  1512 64.20% 35.80% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 95.10% 4.90% 0.00% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 98.70% 1.30% 0.00% 0.00% NA
Temperate Japonica  767 38.20% 61.80% 0.00% 0.00% NA
Tropical Japonica  504 92.90% 7.10% 0.00% 0.00% NA
Japonica Intermediate  241 86.70% 13.30% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 82.20% 17.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0810145390 A -> G LOC_Os08g16580.1 upstream_gene_variant ; 613.0bp to feature; MODIFIER silent_mutation Average:77.991; most accessible tissue: Minghui63 flower, score: 89.852 N N N N
vg0810145390 A -> G LOC_Os08g16570.1 downstream_gene_variant ; 3665.0bp to feature; MODIFIER silent_mutation Average:77.991; most accessible tissue: Minghui63 flower, score: 89.852 N N N N
vg0810145390 A -> G LOC_Os08g16590.1 downstream_gene_variant ; 2524.0bp to feature; MODIFIER silent_mutation Average:77.991; most accessible tissue: Minghui63 flower, score: 89.852 N N N N
vg0810145390 A -> G LOC_Os08g16570.3 downstream_gene_variant ; 3665.0bp to feature; MODIFIER silent_mutation Average:77.991; most accessible tissue: Minghui63 flower, score: 89.852 N N N N
vg0810145390 A -> G LOC_Os08g16580-LOC_Os08g16590 intergenic_region ; MODIFIER silent_mutation Average:77.991; most accessible tissue: Minghui63 flower, score: 89.852 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0810145390 A G 0.03 0.01 0.01 0.04 0.03 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0810145390 NA 4.13E-06 mr1057 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810145390 1.11E-06 1.26E-14 mr1182 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810145390 NA 6.94E-08 mr1182 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810145390 NA 2.09E-12 mr1282 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810145390 NA 5.73E-07 mr1282 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810145390 NA 6.09E-06 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810145390 NA 4.99E-07 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810145390 NA 3.35E-13 mr1650 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810145390 NA 1.70E-06 mr1650 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810145390 NA 5.66E-11 mr1658 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810145390 NA 4.07E-06 mr1658 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810145390 7.37E-09 1.30E-08 mr1057_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810145390 NA 1.06E-10 mr1057_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810145390 NA 6.79E-13 mr1182_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810145390 NA 6.47E-06 mr1182_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810145390 NA 8.31E-11 mr1282_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810145390 NA 7.64E-06 mr1627_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251