\
| Variant ID: vg0810067400 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 10067400 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
CTTGCCGCCCATACAGAGGGCGGCAAGGGGCTAATTGCAATTTTGGCCGCCCATAAAGAGCTTGCGGCCGTACTTTTTGCATCTGGGTCCCTTGCCGCCC[T/C]
AATATGTAAAAAGTACGGCCAAAAGATTTTTCTATGTTATGTTAATAATAAATAAAGAAGTATTTATTGGTAAAACTTGTTAATATTGTTATAAAAATGT
ACATTTTTATAACAATATTAACAAGTTTTACCAATAAATACTTCTTTATTTATTATTAACATAACATAGAAAAATCTTTTGGCCGTACTTTTTACATATT[A/G]
GGGCGGCAAGGGACCCAGATGCAAAAAGTACGGCCGCAAGCTCTTTATGGGCGGCCAAAATTGCAATTAGCCCCTTGCCGCCCTCTGTATGGGCGGCAAG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 32.10% | 0.50% | 0.80% | 66.53% | NA |
| All Indica | 2759 | 24.80% | 0.70% | 1.09% | 73.36% | NA |
| All Japonica | 1512 | 52.10% | 0.00% | 0.20% | 47.75% | NA |
| Aus | 269 | 3.70% | 0.70% | 0.37% | 95.17% | NA |
| Indica I | 595 | 16.60% | 1.20% | 0.84% | 81.34% | NA |
| Indica II | 465 | 39.10% | 0.90% | 0.86% | 59.14% | NA |
| Indica III | 913 | 25.60% | 0.20% | 1.20% | 72.95% | NA |
| Indica Intermediate | 786 | 21.60% | 0.90% | 1.27% | 76.21% | NA |
| Temperate Japonica | 767 | 87.20% | 0.00% | 0.00% | 12.78% | NA |
| Tropical Japonica | 504 | 8.90% | 0.00% | 0.60% | 90.48% | NA |
| Japonica Intermediate | 241 | 30.30% | 0.00% | 0.00% | 69.71% | NA |
| VI/Aromatic | 96 | 3.10% | 3.10% | 3.12% | 90.62% | NA |
| Intermediate | 90 | 37.80% | 0.00% | 1.11% | 61.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0810067400 | T -> C | LOC_Os08g16450.1 | upstream_gene_variant ; 4463.0bp to feature; MODIFIER | silent_mutation | Average:31.377; most accessible tissue: Zhenshan97 panicle, score: 54.901 | N | N | N | N |
| vg0810067400 | T -> C | LOC_Os08g16440.1 | downstream_gene_variant ; 869.0bp to feature; MODIFIER | silent_mutation | Average:31.377; most accessible tissue: Zhenshan97 panicle, score: 54.901 | N | N | N | N |
| vg0810067400 | T -> C | LOC_Os08g16430-LOC_Os08g16440 | intergenic_region ; MODIFIER | silent_mutation | Average:31.377; most accessible tissue: Zhenshan97 panicle, score: 54.901 | N | N | N | N |
| vg0810067400 | T -> DEL | N | N | silent_mutation | Average:31.377; most accessible tissue: Zhenshan97 panicle, score: 54.901 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0810067400 | NA | 1.83E-06 | mr1063 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0810067400 | NA | 2.47E-12 | mr1069 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0810067400 | NA | 2.75E-06 | mr1069 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0810067400 | NA | 1.36E-06 | mr1072 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0810067400 | NA | 6.27E-07 | mr1075 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0810067400 | NA | 9.81E-09 | mr1183 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0810067400 | 5.26E-06 | 8.22E-08 | mr1202 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0810067400 | NA | 2.95E-13 | mr1441 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0810067400 | NA | 1.98E-07 | mr1441 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0810067400 | NA | 6.69E-08 | mr1503 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0810067400 | NA | 7.66E-09 | mr1510 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0810067400 | 4.71E-06 | 4.71E-06 | mr1562 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |