Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0810050412:

Variant ID: vg0810050412 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 10050412
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.60, G: 0.40, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:

TTTTGCTTTGGCTTATTAGGCCAACCGATAAGGCTCTTAAACTACCAATAAGTTGGGTACTACTTTTTCAGATGTTCTTAGTTTAGTGTAGCTTTATGGT[A/G]
TGGTTTTTTCTGTGTATTGTTTAACCTATTTTTTCTCGGGTGTTCCTTTTTGTCCTAGAATTACTATACAATTGTCAACAATTTTTCTCCAAAAAGCCTT

Reverse complement sequence

AAGGCTTTTTGGAGAAAAATTGTTGACAATTGTATAGTAATTCTAGGACAAAAAGGAACACCCGAGAAAAAATAGGTTAAACAATACACAGAAAAAACCA[T/C]
ACCATAAAGCTACACTAAACTAAGAACATCTGAAAAAGTAGTACCCAACTTATTGGTAGTTTAAGAGCCTTATCGGTTGGCCTAATAAGCCAAAGCAAAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	57.40%	16.10%	0.15%	26.36%	NA
All Indica	2759	76.40%	4.70%	0.18%	18.74%	NA
All Japonica	1512	25.60%	33.50%	0.13%	40.81%	NA
Aus	269	61.30%	36.80%	0.00%	1.86%	NA
Indica I	595	86.60%	9.60%	0.17%	3.70%	NA
Indica II	465	75.90%	2.60%	0.22%	21.29%	NA
Indica III	913	70.30%	1.10%	0.00%	28.59%	NA
Indica Intermediate	786	76.00%	6.50%	0.38%	17.18%	NA
Temperate Japonica	767	36.10%	54.60%	0.26%	9.00%	NA
Tropical Japonica	504	8.10%	9.50%	0.00%	82.34%	NA
Japonica Intermediate	241	28.60%	16.20%	0.00%	55.19%	NA
VI/Aromatic	96	11.50%	2.10%	0.00%	86.46%	NA
Intermediate	90	47.80%	25.60%	0.00%	26.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0810050412	A -> G	LOC_Os08g16430.1	upstream_gene_variant ; 1113.0bp to feature; MODIFIER	silent_mutation	Average:40.857; most accessible tissue: Zhenshan97 young leaf, score: 48.658	N	N	N	N
vg0810050412	A -> G	LOC_Os08g16420-LOC_Os08g16430	intergenic_region ; MODIFIER	silent_mutation	Average:40.857; most accessible tissue: Zhenshan97 young leaf, score: 48.658	N	N	N	N
vg0810050412	A -> DEL	N	N	silent_mutation	Average:40.857; most accessible tissue: Zhenshan97 young leaf, score: 48.658	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0810050412	NA	7.55E-06	mr1069	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810050412	NA	1.80E-06	mr1164	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810050412	NA	4.88E-07	mr1617	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810050412	NA	5.51E-08	mr1627	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810050412	NA	7.54E-06	mr1057_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810050412	NA	1.32E-06	mr1164_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810050412	NA	3.41E-07	mr1627_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251