\
| Variant ID: vg0810050412 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 10050412 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.60, G: 0.40, others allele: 0.00, population size: 92. )
TTTTGCTTTGGCTTATTAGGCCAACCGATAAGGCTCTTAAACTACCAATAAGTTGGGTACTACTTTTTCAGATGTTCTTAGTTTAGTGTAGCTTTATGGT[A/G]
TGGTTTTTTCTGTGTATTGTTTAACCTATTTTTTCTCGGGTGTTCCTTTTTGTCCTAGAATTACTATACAATTGTCAACAATTTTTCTCCAAAAAGCCTT
AAGGCTTTTTGGAGAAAAATTGTTGACAATTGTATAGTAATTCTAGGACAAAAAGGAACACCCGAGAAAAAATAGGTTAAACAATACACAGAAAAAACCA[T/C]
ACCATAAAGCTACACTAAACTAAGAACATCTGAAAAAGTAGTACCCAACTTATTGGTAGTTTAAGAGCCTTATCGGTTGGCCTAATAAGCCAAAGCAAAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 57.40% | 16.10% | 0.15% | 26.36% | NA |
| All Indica | 2759 | 76.40% | 4.70% | 0.18% | 18.74% | NA |
| All Japonica | 1512 | 25.60% | 33.50% | 0.13% | 40.81% | NA |
| Aus | 269 | 61.30% | 36.80% | 0.00% | 1.86% | NA |
| Indica I | 595 | 86.60% | 9.60% | 0.17% | 3.70% | NA |
| Indica II | 465 | 75.90% | 2.60% | 0.22% | 21.29% | NA |
| Indica III | 913 | 70.30% | 1.10% | 0.00% | 28.59% | NA |
| Indica Intermediate | 786 | 76.00% | 6.50% | 0.38% | 17.18% | NA |
| Temperate Japonica | 767 | 36.10% | 54.60% | 0.26% | 9.00% | NA |
| Tropical Japonica | 504 | 8.10% | 9.50% | 0.00% | 82.34% | NA |
| Japonica Intermediate | 241 | 28.60% | 16.20% | 0.00% | 55.19% | NA |
| VI/Aromatic | 96 | 11.50% | 2.10% | 0.00% | 86.46% | NA |
| Intermediate | 90 | 47.80% | 25.60% | 0.00% | 26.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0810050412 | A -> G | LOC_Os08g16430.1 | upstream_gene_variant ; 1113.0bp to feature; MODIFIER | silent_mutation | Average:40.857; most accessible tissue: Zhenshan97 young leaf, score: 48.658 | N | N | N | N |
| vg0810050412 | A -> G | LOC_Os08g16420-LOC_Os08g16430 | intergenic_region ; MODIFIER | silent_mutation | Average:40.857; most accessible tissue: Zhenshan97 young leaf, score: 48.658 | N | N | N | N |
| vg0810050412 | A -> DEL | N | N | silent_mutation | Average:40.857; most accessible tissue: Zhenshan97 young leaf, score: 48.658 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0810050412 | NA | 7.55E-06 | mr1069 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0810050412 | NA | 1.80E-06 | mr1164 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0810050412 | NA | 4.88E-07 | mr1617 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0810050412 | NA | 5.51E-08 | mr1627 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0810050412 | NA | 7.54E-06 | mr1057_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0810050412 | NA | 1.32E-06 | mr1164_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0810050412 | NA | 3.41E-07 | mr1627_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |