\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0809948045:

Variant ID: vg0809948045 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 9948045
Reference Allele: CAlternative Allele: T,A
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACTTAAACGGCCTCATTCTGACTTCATAAGAATTAATTACGAATTTTACAAAATTTAATCTAATTAAAGCCCATTTAAAAAGGATTAAATAAATTTAATT[C/T,A]
AATTTATCGATAATTTTAATATATAGATCTTTATTTTATACAACTTTTGCAACTTGAACCACATTAAACCGAGTTACAATGAATTAGTTATGAAACTTTA

Reverse complement sequence

TAAAGTTTCATAACTAATTCATTGTAACTCGGTTTAATGTGGTTCAAGTTGCAAAAGTTGTATAAAATAAAGATCTATATATTAAAATTATCGATAAATT[G/A,T]
AATTAAATTTATTTAATCCTTTTTAAATGGGCTTTAATTAGATTAAATTTTGTAAAATTCGTAATTAATTCTTATGAAGTCAGAATGAGGCCGTTTAAGT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.10% 36.00% 0.15% 0.00% A: 8.82%
All Indica  2759 69.00% 25.40% 0.22% 0.00% A: 5.40%
All Japonica  1512 33.70% 55.20% 0.00% 0.00% A: 11.18%
Aus  269 51.70% 48.30% 0.00% 0.00% NA
Indica I  595 82.90% 17.10% 0.00% 0.00% NA
Indica II  465 48.00% 36.10% 0.65% 0.00% A: 15.27%
Indica III  913 68.90% 26.00% 0.22% 0.00% A: 4.93%
Indica Intermediate  786 71.00% 24.70% 0.13% 0.00% A: 4.20%
Temperate Japonica  767 6.40% 93.40% 0.00% 0.00% A: 0.26%
Tropical Japonica  504 62.70% 8.30% 0.00% 0.00% A: 28.97%
Japonica Intermediate  241 59.80% 31.50% 0.00% 0.00% A: 8.71%
VI/Aromatic  96 9.40% 1.00% 1.04% 0.00% A: 88.54%
Intermediate  90 47.80% 36.70% 0.00% 0.00% A: 15.56%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0809948045 C -> T LOC_Os08g16290.1 upstream_gene_variant ; 941.0bp to feature; MODIFIER silent_mutation Average:20.802; most accessible tissue: Callus, score: 32.223 N N N N
vg0809948045 C -> T LOC_Os08g16290-LOC_Os08g16300 intergenic_region ; MODIFIER silent_mutation Average:20.802; most accessible tissue: Callus, score: 32.223 N N N N
vg0809948045 C -> A LOC_Os08g16290.1 upstream_gene_variant ; 941.0bp to feature; MODIFIER silent_mutation Average:20.802; most accessible tissue: Callus, score: 32.223 N N N N
vg0809948045 C -> A LOC_Os08g16290-LOC_Os08g16300 intergenic_region ; MODIFIER silent_mutation Average:20.802; most accessible tissue: Callus, score: 32.223 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0809948045 NA 8.40E-07 mr1069 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809948045 NA 1.32E-07 mr1072 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809948045 5.35E-06 3.33E-07 mr1075 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809948045 NA 8.28E-06 mr1124 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809948045 NA 1.99E-07 mr1180 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809948045 NA 8.33E-09 mr1183 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809948045 1.44E-06 2.42E-08 mr1202 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809948045 NA 2.96E-07 mr1441 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809948045 NA 1.69E-07 mr1503 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809948045 NA 4.76E-07 mr1149_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809948045 NA 2.58E-06 mr1509_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809948045 NA 3.93E-06 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251