Variant ID: vg0809948045 (JBrowse) | Variation Type: SNP |
Chromosome: chr08 | Position: 9948045 |
Reference Allele: C | Alternative Allele: T,A |
Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
ACTTAAACGGCCTCATTCTGACTTCATAAGAATTAATTACGAATTTTACAAAATTTAATCTAATTAAAGCCCATTTAAAAAGGATTAAATAAATTTAATT[C/T,A]
AATTTATCGATAATTTTAATATATAGATCTTTATTTTATACAACTTTTGCAACTTGAACCACATTAAACCGAGTTACAATGAATTAGTTATGAAACTTTA
TAAAGTTTCATAACTAATTCATTGTAACTCGGTTTAATGTGGTTCAAGTTGCAAAAGTTGTATAAAATAAAGATCTATATATTAAAATTATCGATAAATT[G/A,T]
AATTAAATTTATTTAATCCTTTTTAAATGGGCTTTAATTAGATTAAATTTTGTAAAATTCGTAATTAATTCTTATGAAGTCAGAATGAGGCCGTTTAAGT
Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 55.10% | 36.00% | 0.15% | 0.00% | A: 8.82% |
All Indica | 2759 | 69.00% | 25.40% | 0.22% | 0.00% | A: 5.40% |
All Japonica | 1512 | 33.70% | 55.20% | 0.00% | 0.00% | A: 11.18% |
Aus | 269 | 51.70% | 48.30% | 0.00% | 0.00% | NA |
Indica I | 595 | 82.90% | 17.10% | 0.00% | 0.00% | NA |
Indica II | 465 | 48.00% | 36.10% | 0.65% | 0.00% | A: 15.27% |
Indica III | 913 | 68.90% | 26.00% | 0.22% | 0.00% | A: 4.93% |
Indica Intermediate | 786 | 71.00% | 24.70% | 0.13% | 0.00% | A: 4.20% |
Temperate Japonica | 767 | 6.40% | 93.40% | 0.00% | 0.00% | A: 0.26% |
Tropical Japonica | 504 | 62.70% | 8.30% | 0.00% | 0.00% | A: 28.97% |
Japonica Intermediate | 241 | 59.80% | 31.50% | 0.00% | 0.00% | A: 8.71% |
VI/Aromatic | 96 | 9.40% | 1.00% | 1.04% | 0.00% | A: 88.54% |
Intermediate | 90 | 47.80% | 36.70% | 0.00% | 0.00% | A: 15.56% |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0809948045 | C -> T | LOC_Os08g16290.1 | upstream_gene_variant ; 941.0bp to feature; MODIFIER | silent_mutation | Average:20.802; most accessible tissue: Callus, score: 32.223 | N | N | N | N |
vg0809948045 | C -> T | LOC_Os08g16290-LOC_Os08g16300 | intergenic_region ; MODIFIER | silent_mutation | Average:20.802; most accessible tissue: Callus, score: 32.223 | N | N | N | N |
vg0809948045 | C -> A | LOC_Os08g16290.1 | upstream_gene_variant ; 941.0bp to feature; MODIFIER | silent_mutation | Average:20.802; most accessible tissue: Callus, score: 32.223 | N | N | N | N |
vg0809948045 | C -> A | LOC_Os08g16290-LOC_Os08g16300 | intergenic_region ; MODIFIER | silent_mutation | Average:20.802; most accessible tissue: Callus, score: 32.223 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0809948045 | NA | 8.40E-07 | mr1069 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0809948045 | NA | 1.32E-07 | mr1072 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0809948045 | 5.35E-06 | 3.33E-07 | mr1075 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0809948045 | NA | 8.28E-06 | mr1124 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0809948045 | NA | 1.99E-07 | mr1180 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0809948045 | NA | 8.33E-09 | mr1183 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0809948045 | 1.44E-06 | 2.42E-08 | mr1202 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0809948045 | NA | 2.96E-07 | mr1441 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0809948045 | NA | 1.69E-07 | mr1503 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0809948045 | NA | 4.76E-07 | mr1149_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0809948045 | NA | 2.58E-06 | mr1509_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0809948045 | NA | 3.93E-06 | mr1977_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |