\
| Variant ID: vg0809946687 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr08 | Position: 9946687 |
| Reference Allele: C | Alternative Allele: T,CAAGGTG |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 245. )
CTGGGGTATAAGCCAAACGTCTTCTCCTTCGCAACTTGTCTTCAACTGAGGTTTGATTGATTATTGCAAGGTGAGTACATGGAATACTCCGCAAGCCACA[C/T,CAAGGTG]
AGCAAATAAGTAAGTGCACAAGGATACCAAAGGATGGCATAATATAGGGCTCATTTGCAAAAGCAGCATTTAGCAAACATTTGAGAATTGTAAAACAGTA
TACTGTTTTACAATTCTCAAATGTTTGCTAAATGCTGCTTTTGCAAATGAGCCCTATATTATGCCATCCTTTGGTATCCTTGTGCACTTACTTATTTGCT[G/A,CACCTTG]
TGTGGCTTGCGGAGTATTCCATGTACTCACCTTGCAATAATCAATCAAACCTCAGTTGAAGACAAGTTGCGAAGGAGAAGACGTTTGGCTTATACCCCAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 85.70% | 14.20% | 0.11% | 0.00% | NA |
| All Indica | 2759 | 80.70% | 19.10% | 0.18% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 50.60% | 49.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 63.40% | 36.10% | 0.50% | 0.00% | NA |
| Indica II | 465 | 96.30% | 3.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 80.40% | 19.50% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 84.90% | 15.00% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0809946687 | C -> CAAGGTG | LOC_Os08g16290.1 | intron_variant ; MODIFIER | N | Average:45.346; most accessible tissue: Minghui63 young leaf, score: 58.21 | N | N | N | N |
| vg0809946687 | C -> T | LOC_Os08g16290.1 | intron_variant ; MODIFIER | silent_mutation | Average:45.346; most accessible tissue: Minghui63 young leaf, score: 58.21 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0809946687 | NA | 5.96E-07 | mr1072 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0809946687 | NA | 9.95E-07 | mr1124 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0809946687 | NA | 2.76E-12 | mr1222 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0809946687 | NA | 3.91E-06 | mr1222 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0809946687 | NA | 1.30E-07 | mr1861 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0809946687 | NA | 3.52E-07 | mr1962 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0809946687 | NA | 1.96E-10 | mr1222_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0809946687 | NA | 4.86E-06 | mr1222_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |