\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0809915175:

Variant ID: vg0809915175 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 9915175
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.05, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:


CGCACGCTTAATGGACCGAAATAAGGGGGTTGGATGGAGATCCAATATGAGCTTAATTCGGATAGGGATCCGAATAGGAGTCCTACGGGCCTTTAAGGCC[C/T]
GAGTGATGGATCCTATATATTCGTGAGGGGTGTGACCGGCGGAGGTATTGCATCACGTGAGAAACCCTAGCCGTCACTCCCCTCCCCGAGAAAAACCCTA

Reverse complement sequence

TAGGGTTTTTCTCGGGGAGGGGAGTGACGGCTAGGGTTTCTCACGTGATGCAATACCTCCGCCGGTCACACCCCTCACGAATATATAGGATCCATCACTC[G/A]
GGCCTTAAAGGCCCGTAGGACTCCTATTCGGATCCCTATCCGAATTAAGCTCATATTGGATCTCCATCCAACCCCCTTATTTCGGTCCATTAAGCGTGCG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.40% 24.10% 0.13% 0.38% NA
All Indica  2759 84.50% 14.90% 0.00% 0.58% NA
All Japonica  1512 59.70% 40.20% 0.13% 0.00% NA
Aus  269 98.50% 1.50% 0.00% 0.00% NA
Indica I  595 95.60% 4.00% 0.00% 0.34% NA
Indica II  465 91.40% 8.60% 0.00% 0.00% NA
Indica III  913 73.30% 25.70% 0.00% 0.99% NA
Indica Intermediate  786 85.00% 14.40% 0.00% 0.64% NA
Temperate Japonica  767 90.90% 9.10% 0.00% 0.00% NA
Tropical Japonica  504 19.60% 80.00% 0.40% 0.00% NA
Japonica Intermediate  241 44.00% 56.00% 0.00% 0.00% NA
VI/Aromatic  96 6.20% 90.60% 3.12% 0.00% NA
Intermediate  90 66.70% 30.00% 1.11% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0809915175 C -> T LOC_Os08g16250.1 downstream_gene_variant ; 77.0bp to feature; MODIFIER silent_mutation Average:64.008; most accessible tissue: Zhenshan97 flag leaf, score: 77.738 N N N N
vg0809915175 C -> T LOC_Os08g16255.1 downstream_gene_variant ; 2596.0bp to feature; MODIFIER silent_mutation Average:64.008; most accessible tissue: Zhenshan97 flag leaf, score: 77.738 N N N N
vg0809915175 C -> T LOC_Os08g16250-LOC_Os08g16255 intergenic_region ; MODIFIER silent_mutation Average:64.008; most accessible tissue: Zhenshan97 flag leaf, score: 77.738 N N N N
vg0809915175 C -> DEL N N silent_mutation Average:64.008; most accessible tissue: Zhenshan97 flag leaf, score: 77.738 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0809915175 NA 1.02E-06 mr1045 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809915175 NA 1.17E-07 mr1206 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809915175 NA 5.55E-06 mr1263 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809915175 NA 4.42E-06 mr1309 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809915175 NA 5.55E-06 mr1451 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809915175 NA 9.10E-07 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809915175 NA 1.29E-06 mr1550 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809915175 NA 7.42E-06 mr1596 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809915175 NA 1.11E-09 mr1668 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809915175 NA 2.14E-06 mr1671 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809915175 NA 4.75E-06 mr1689 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809915175 NA 7.83E-06 mr1751 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809915175 NA 6.06E-06 mr1763 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809915175 NA 2.04E-06 mr1775 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809915175 NA 9.65E-07 mr1841 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809915175 NA 1.05E-07 mr1864 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809915175 NA 2.72E-06 mr1045_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809915175 NA 5.75E-06 mr1206_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809915175 NA 3.25E-07 mr1246_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809915175 NA 1.18E-08 mr1404_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809915175 NA 2.52E-09 mr1521_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809915175 NA 3.63E-06 mr1550_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809915175 NA 1.83E-06 mr1620_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809915175 NA 2.31E-06 mr1668_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809915175 NA 4.27E-09 mr1671_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809915175 NA 2.48E-08 mr1746_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809915175 NA 1.60E-07 mr1880_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809915175 NA 2.08E-06 mr1900_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251