| Variant ID: vg0809915175 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 9915175 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.05, others allele: 0.00, population size: 236. )
CGCACGCTTAATGGACCGAAATAAGGGGGTTGGATGGAGATCCAATATGAGCTTAATTCGGATAGGGATCCGAATAGGAGTCCTACGGGCCTTTAAGGCC[C/T]
GAGTGATGGATCCTATATATTCGTGAGGGGTGTGACCGGCGGAGGTATTGCATCACGTGAGAAACCCTAGCCGTCACTCCCCTCCCCGAGAAAAACCCTA
TAGGGTTTTTCTCGGGGAGGGGAGTGACGGCTAGGGTTTCTCACGTGATGCAATACCTCCGCCGGTCACACCCCTCACGAATATATAGGATCCATCACTC[G/A]
GGCCTTAAAGGCCCGTAGGACTCCTATTCGGATCCCTATCCGAATTAAGCTCATATTGGATCTCCATCCAACCCCCTTATTTCGGTCCATTAAGCGTGCG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 75.40% | 24.10% | 0.13% | 0.38% | NA |
| All Indica | 2759 | 84.50% | 14.90% | 0.00% | 0.58% | NA |
| All Japonica | 1512 | 59.70% | 40.20% | 0.13% | 0.00% | NA |
| Aus | 269 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 95.60% | 4.00% | 0.00% | 0.34% | NA |
| Indica II | 465 | 91.40% | 8.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 73.30% | 25.70% | 0.00% | 0.99% | NA |
| Indica Intermediate | 786 | 85.00% | 14.40% | 0.00% | 0.64% | NA |
| Temperate Japonica | 767 | 90.90% | 9.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 19.60% | 80.00% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 44.00% | 56.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 6.20% | 90.60% | 3.12% | 0.00% | NA |
| Intermediate | 90 | 66.70% | 30.00% | 1.11% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0809915175 | C -> T | LOC_Os08g16250.1 | downstream_gene_variant ; 77.0bp to feature; MODIFIER | silent_mutation | Average:64.008; most accessible tissue: Zhenshan97 flag leaf, score: 77.738 | N | N | N | N |
| vg0809915175 | C -> T | LOC_Os08g16255.1 | downstream_gene_variant ; 2596.0bp to feature; MODIFIER | silent_mutation | Average:64.008; most accessible tissue: Zhenshan97 flag leaf, score: 77.738 | N | N | N | N |
| vg0809915175 | C -> T | LOC_Os08g16250-LOC_Os08g16255 | intergenic_region ; MODIFIER | silent_mutation | Average:64.008; most accessible tissue: Zhenshan97 flag leaf, score: 77.738 | N | N | N | N |
| vg0809915175 | C -> DEL | N | N | silent_mutation | Average:64.008; most accessible tissue: Zhenshan97 flag leaf, score: 77.738 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0809915175 | NA | 1.02E-06 | mr1045 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0809915175 | NA | 1.17E-07 | mr1206 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0809915175 | NA | 5.55E-06 | mr1263 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0809915175 | NA | 4.42E-06 | mr1309 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0809915175 | NA | 5.55E-06 | mr1451 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0809915175 | NA | 9.10E-07 | mr1521 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0809915175 | NA | 1.29E-06 | mr1550 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0809915175 | NA | 7.42E-06 | mr1596 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0809915175 | NA | 1.11E-09 | mr1668 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0809915175 | NA | 2.14E-06 | mr1671 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/