Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0809915175:

Variant ID: vg0809915175 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 9915175
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.05, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:

CGCACGCTTAATGGACCGAAATAAGGGGGTTGGATGGAGATCCAATATGAGCTTAATTCGGATAGGGATCCGAATAGGAGTCCTACGGGCCTTTAAGGCC[C/T]
GAGTGATGGATCCTATATATTCGTGAGGGGTGTGACCGGCGGAGGTATTGCATCACGTGAGAAACCCTAGCCGTCACTCCCCTCCCCGAGAAAAACCCTA

Reverse complement sequence

TAGGGTTTTTCTCGGGGAGGGGAGTGACGGCTAGGGTTTCTCACGTGATGCAATACCTCCGCCGGTCACACCCCTCACGAATATATAGGATCCATCACTC[G/A]
GGCCTTAAAGGCCCGTAGGACTCCTATTCGGATCCCTATCCGAATTAAGCTCATATTGGATCTCCATCCAACCCCCTTATTTCGGTCCATTAAGCGTGCG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	75.40%	24.10%	0.13%	0.38%	NA
All Indica	2759	84.50%	14.90%	0.00%	0.58%	NA
All Japonica	1512	59.70%	40.20%	0.13%	0.00%	NA
Aus	269	98.50%	1.50%	0.00%	0.00%	NA
Indica I	595	95.60%	4.00%	0.00%	0.34%	NA
Indica II	465	91.40%	8.60%	0.00%	0.00%	NA
Indica III	913	73.30%	25.70%	0.00%	0.99%	NA
Indica Intermediate	786	85.00%	14.40%	0.00%	0.64%	NA
Temperate Japonica	767	90.90%	9.10%	0.00%	0.00%	NA
Tropical Japonica	504	19.60%	80.00%	0.40%	0.00%	NA
Japonica Intermediate	241	44.00%	56.00%	0.00%	0.00%	NA
VI/Aromatic	96	6.20%	90.60%	3.12%	0.00%	NA
Intermediate	90	66.70%	30.00%	1.11%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0809915175	C -> T	LOC_Os08g16250.1	downstream_gene_variant ; 77.0bp to feature; MODIFIER	silent_mutation	Average:64.008; most accessible tissue: Zhenshan97 flag leaf, score: 77.738	N	N	N	N
vg0809915175	C -> T	LOC_Os08g16255.1	downstream_gene_variant ; 2596.0bp to feature; MODIFIER	silent_mutation	Average:64.008; most accessible tissue: Zhenshan97 flag leaf, score: 77.738	N	N	N	N
vg0809915175	C -> T	LOC_Os08g16250-LOC_Os08g16255	intergenic_region ; MODIFIER	silent_mutation	Average:64.008; most accessible tissue: Zhenshan97 flag leaf, score: 77.738	N	N	N	N
vg0809915175	C -> DEL	N	N	silent_mutation	Average:64.008; most accessible tissue: Zhenshan97 flag leaf, score: 77.738	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0809915175	NA	1.02E-06	mr1045	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809915175	NA	1.17E-07	mr1206	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809915175	NA	5.55E-06	mr1263	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809915175	NA	4.42E-06	mr1309	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809915175	NA	5.55E-06	mr1451	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809915175	NA	9.10E-07	mr1521	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809915175	NA	1.29E-06	mr1550	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809915175	NA	7.42E-06	mr1596	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809915175	NA	1.11E-09	mr1668	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809915175	NA	2.14E-06	mr1671	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809915175	NA	4.75E-06	mr1689	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809915175	NA	7.83E-06	mr1751	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809915175	NA	6.06E-06	mr1763	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809915175	NA	2.04E-06	mr1775	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809915175	NA	9.65E-07	mr1841	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809915175	NA	1.05E-07	mr1864	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809915175	NA	2.72E-06	mr1045_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809915175	NA	5.75E-06	mr1206_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809915175	NA	3.25E-07	mr1246_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809915175	NA	1.18E-08	mr1404_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809915175	NA	2.52E-09	mr1521_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809915175	NA	3.63E-06	mr1550_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809915175	NA	1.83E-06	mr1620_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809915175	NA	2.31E-06	mr1668_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809915175	NA	4.27E-09	mr1671_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809915175	NA	2.48E-08	mr1746_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809915175	NA	1.60E-07	mr1880_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809915175	NA	2.08E-06	mr1900_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251