RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0809871494:

Variant ID: vg0809871494 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 9871494
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 281. )

Flanking Sequence (100 bp) in Reference Genome:

CCAAGCGCCACAAACAGTGGCGGAAGGGGCTTCGGCTCTTCAGGCGCAACTCCAAACTTTCCTTCAGCAACTCAACCAACCCCACTGCATTTCAAGTACA[A/G]
CCCCATCGGCCCACCCGGAGGGGAATACAAGTCAAGGTGCGCCTAATTGGTTGCCACCGATTCAGCCGGGCCTGGGAGTTTCGCCGTGGAATCAAGGACC

Reverse complement sequence

GGTCCTTGATTCCACGGCGAAACTCCCAGGCCCGGCTGAATCGGTGGCAACCAATTAGGCGCACCTTGACTTGTATTCCCCTCCGGGTGGGCCGATGGGG[T/C]
TGTACTTGAAATGCAGTGGGGTTGGTTGAGTTGCTGAAGGAAAGTTTGGAGTTGCGCCTGAAGAGCCGAAGCCCCTTCCGCCACTGTTTGTGGCGCTTGG

Allele Frequencies:

Search:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.90%	9.10%	0.00%	0.00%	NA
All Indica	2759	99.90%	0.10%	0.00%	0.00%	NA
All Japonica	1512	72.80%	27.20%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	99.80%	0.20%	0.00%	0.00%	NA
Indica Intermediate	786	99.90%	0.10%	0.00%	0.00%	NA
Temperate Japonica	767	97.80%	2.20%	0.00%	0.00%	NA
Tropical Japonica	504	44.20%	55.80%	0.00%	0.00%	NA
Japonica Intermediate	241	52.70%	47.30%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	86.70%	13.30%	0.00%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0809871494	A -> G	LOC_Os08g16190.1	missense_variant ; p.Thr234Ala; MODERATE	nonsynonymous_codon ; T234A	Average:57.446; most accessible tissue: Zhenshan97 flag leaf, score: 84.295	benign	0.781	TOLERATED	0.32

Showing 1 to 1 of 1 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0809871494	NA	3.60E-07	mr1040	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809871494	NA	1.26E-08	mr1045	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809871494	NA	9.04E-06	mr1095	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809871494	NA	2.55E-09	mr1194	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809871494	NA	4.52E-06	mr1482	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809871494	NA	3.11E-06	mr1521	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809871494	NA	1.06E-07	mr1668	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809871494	NA	1.74E-07	mr1746	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809871494	NA	5.51E-07	mr1194_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 9 of 9 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg0809871494:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact