Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0809845346:

Variant ID: vg0809845346 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 9845346
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GAAAGGCAATTGTCAATTATATGAATTTAAAAAAATAATAGGAATTTTAAACTATGTATAAGACATTTGTTAATTATATGTGATAAATCAAATGTAATAG[C/A]
AATTTTAAATCGGGTAGAAGTTAATTATAAATGATTTTTATAACTTAAAAACATTTTAATAAGTCATCTGTGACGGGCTTTAGTACTATGCCCGATAGAG

Reverse complement sequence

CTCTATCGGGCATAGTACTAAAGCCCGTCACAGATGACTTATTAAAATGTTTTTAAGTTATAAAAATCATTTATAATTAACTTCTACCCGATTTAAAATT[G/T]
CTATTACATTTGATTTATCACATATAATTAACAAATGTCTTATACATAGTTTAAAATTCCTATTATTTTTTTAAATTCATATAATTGACAATTGCCTTTC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	91.10%	8.80%	0.13%	0.00%	NA
All Indica	2759	99.90%	0.10%	0.00%	0.00%	NA
All Japonica	1512	73.10%	26.50%	0.40%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	100.00%	0.00%	0.00%	0.00%	NA
Temperate Japonica	767	97.90%	2.10%	0.00%	0.00%	NA
Tropical Japonica	504	45.20%	53.80%	0.99%	0.00%	NA
Japonica Intermediate	241	52.70%	46.90%	0.41%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	87.80%	12.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0809845346	C -> A	LOC_Os08g16160.1	upstream_gene_variant ; 2438.0bp to feature; MODIFIER	silent_mutation	Average:31.315; most accessible tissue: Zhenshan97 flag leaf, score: 55.285	N	N	N	N
vg0809845346	C -> A	LOC_Os08g16140.1	downstream_gene_variant ; 366.0bp to feature; MODIFIER	silent_mutation	Average:31.315; most accessible tissue: Zhenshan97 flag leaf, score: 55.285	N	N	N	N
vg0809845346	C -> A	LOC_Os08g16150.1	downstream_gene_variant ; 359.0bp to feature; MODIFIER	silent_mutation	Average:31.315; most accessible tissue: Zhenshan97 flag leaf, score: 55.285	N	N	N	N
vg0809845346	C -> A	LOC_Os08g16140-LOC_Os08g16150	intergenic_region ; MODIFIER	silent_mutation	Average:31.315; most accessible tissue: Zhenshan97 flag leaf, score: 55.285	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0809845346	NA	6.95E-12	Grain_weight	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0809845346	NA	9.81E-06	mr1095	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809845346	3.01E-06	4.63E-16	mr1871	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809845346	NA	1.33E-06	mr1871	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809845346	NA	1.97E-06	mr1194_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809845346	NA	2.85E-06	mr1383_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809845346	9.31E-10	1.89E-27	mr1871_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809845346	NA	3.31E-10	mr1871_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251