Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0809823049:

Variant ID: vg0809823049 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 9823049
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.84, A: 0.17, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


ATCAAACGTCGACAAAAAGTATTTTAGGCGATTTAGAAAGTGCCTCTAAAAAGTGTCTCACGACTATAGAGGTCCAGATTTTAGAGGCAATTTGAAAATC[G/A]
CCTCTACAAAACCGGCATCTTTAATTTATCATAGGTACTTAGTTAATTAAAACTGTCACCTGTAATATATTACAAGTATCGGTTATTTTAAAATTACTAA

Reverse complement sequence

TTAGTAATTTTAAAATAACCGATACTTGTAATATATTACAGGTGACAGTTTTAATTAACTAAGTACCTATGATAAATTAAAGATGCCGGTTTTGTAGAGG[C/T]
GATTTTCAAATTGCCTCTAAAATCTGGACCTCTATAGTCGTGAGACACTTTTTAGAGGCACTTTCTAAATCGCCTAAAATACTTTTTGTCGACGTTTGAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.10% 38.80% 0.11% 0.00% NA
All Indica  2759 59.00% 40.90% 0.11% 0.00% NA
All Japonica  1512 64.60% 35.30% 0.07% 0.00% NA
Aus  269 48.00% 52.00% 0.00% 0.00% NA
Indica I  595 60.50% 39.30% 0.17% 0.00% NA
Indica II  465 71.40% 28.40% 0.22% 0.00% NA
Indica III  913 47.50% 52.50% 0.00% 0.00% NA
Indica Intermediate  786 63.70% 36.10% 0.13% 0.00% NA
Temperate Japonica  767 88.40% 11.50% 0.13% 0.00% NA
Tropical Japonica  504 38.90% 61.10% 0.00% 0.00% NA
Japonica Intermediate  241 42.70% 57.30% 0.00% 0.00% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 70.00% 28.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0809823049 G -> A LOC_Os08g16100.1 upstream_gene_variant ; 4647.0bp to feature; MODIFIER silent_mutation Average:42.92; most accessible tissue: Callus, score: 60.553 N N N N
vg0809823049 G -> A LOC_Os08g16110.1 upstream_gene_variant ; 1429.0bp to feature; MODIFIER silent_mutation Average:42.92; most accessible tissue: Callus, score: 60.553 N N N N
vg0809823049 G -> A LOC_Os08g16120.1 upstream_gene_variant ; 1578.0bp to feature; MODIFIER silent_mutation Average:42.92; most accessible tissue: Callus, score: 60.553 N N N N
vg0809823049 G -> A LOC_Os08g16120.2 upstream_gene_variant ; 1578.0bp to feature; MODIFIER silent_mutation Average:42.92; most accessible tissue: Callus, score: 60.553 N N N N
vg0809823049 G -> A LOC_Os08g16110-LOC_Os08g16120 intergenic_region ; MODIFIER silent_mutation Average:42.92; most accessible tissue: Callus, score: 60.553 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0809823049 NA 9.09E-06 mr1028 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809823049 NA 1.63E-06 mr1045 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809823049 NA 1.70E-06 mr1063 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809823049 NA 7.00E-06 mr1084 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809823049 NA 1.12E-07 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809823049 NA 4.83E-06 mr1192 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809823049 NA 6.90E-06 mr1205 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809823049 NA 6.19E-06 mr1280 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809823049 4.53E-06 4.53E-06 mr1476 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809823049 NA 4.97E-06 mr1494 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809823049 NA 4.36E-06 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809823049 NA 6.19E-09 mr1864 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809823049 NA 1.29E-06 mr1194_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251