\
| Variant ID: vg0809725087 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 9725087 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.70, C: 0.30, others allele: 0.00, population size: 53. )
CAGGACCCTTTTGGACTACATCGTGTAGCAGGAGGGTTGCGTAATACGTTATCAGCACGACATTCTACCGGAGACCGAGAAAAAAAAGAAGGGTACGAAA[T/C]
TCGAGAATCCACTTTGCATCTTGTAGATTGAATTGCAAAATCGAATTCCTTGCATCCTCCTCATTCCATTTTTGCGGTTTTCGATGGATTCCATCATCGC
GCGATGATGGAATCCATCGAAAACCGCAAAAATGGAATGAGGAGGATGCAAGGAATTCGATTTTGCAATTCAATCTACAAGATGCAAAGTGGATTCTCGA[A/G]
TTTCGTACCCTTCTTTTTTTTCTCGGTCTCCGGTAGAATGTCGTGCTGATAACGTATTACGCAACCCTCCTGCTACACGATGTAGTCCAAAAGGGTCCTG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.20% | 21.10% | 0.44% | 25.29% | NA |
| All Indica | 2759 | 83.20% | 4.80% | 0.40% | 11.63% | NA |
| All Japonica | 1512 | 3.00% | 55.00% | 0.40% | 41.67% | NA |
| Aus | 269 | 44.60% | 2.20% | 0.74% | 52.42% | NA |
| Indica I | 595 | 87.60% | 12.40% | 0.00% | 0.00% | NA |
| Indica II | 465 | 58.10% | 4.10% | 1.29% | 36.56% | NA |
| Indica III | 913 | 91.60% | 0.80% | 0.33% | 7.34% | NA |
| Indica Intermediate | 786 | 85.00% | 4.10% | 0.25% | 10.69% | NA |
| Temperate Japonica | 767 | 2.20% | 90.20% | 0.39% | 7.17% | NA |
| Tropical Japonica | 504 | 3.40% | 12.10% | 0.40% | 84.13% | NA |
| Japonica Intermediate | 241 | 4.60% | 32.40% | 0.41% | 62.66% | NA |
| VI/Aromatic | 96 | 15.60% | 1.00% | 0.00% | 83.33% | NA |
| Intermediate | 90 | 43.30% | 28.90% | 2.22% | 25.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0809725087 | T -> C | LOC_Os08g15980.1 | downstream_gene_variant ; 4480.0bp to feature; MODIFIER | silent_mutation | Average:44.805; most accessible tissue: Zhenshan97 panicle, score: 85.254 | N | N | N | N |
| vg0809725087 | T -> C | LOC_Os08g15970.1 | intron_variant ; MODIFIER | silent_mutation | Average:44.805; most accessible tissue: Zhenshan97 panicle, score: 85.254 | N | N | N | N |
| vg0809725087 | T -> DEL | N | N | silent_mutation | Average:44.805; most accessible tissue: Zhenshan97 panicle, score: 85.254 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0809725087 | NA | 3.65E-44 | mr1136 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0809725087 | NA | 2.76E-07 | mr1659 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0809725087 | NA | 2.07E-07 | mr1030_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0809725087 | NA | 2.06E-08 | mr1072_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0809725087 | NA | 3.42E-08 | mr1075_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0809725087 | 7.30E-06 | 1.17E-55 | mr1136_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0809725087 | NA | 2.26E-10 | mr1136_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0809725087 | NA | 3.90E-07 | mr1149_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0809725087 | NA | 1.72E-06 | mr1252_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0809725087 | NA | 7.19E-06 | mr1441_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |