| Variant ID: vg0809707295 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 9707295 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.69, G: 0.33, others allele: 0.00, population size: 55. )
AAAGATCAAATATGCCTGTTACCCTTTTGAACCGGGACTAAAGATCATCAGCCCCGGTTTTTATTGTATCCGGGACTATTGTGGAATTCGGCCGACCGAC[A/G]
AAAGATGGTTTCTCCACAAGTGGTTGCTCAGAAACCAGATAAGCCGATACCATCAAAGCTGAGAACTCCTTTACCGTCATCTTCTTCAACAGCATCGGTA
TACCGATGCTGTTGAAGAAGATGACGGTAAAGGAGTTCTCAGCTTTGATGGTATCGGCTTATCTGGTTTCTGAGCAACCACTTGTGGAGAAACCATCTTT[T/C]
GTCGGTCGGCCGAATTCCACAATAGTCCCGGATACAATAAAAACCGGGGCTGATGATCTTTAGTCCCGGTTCAAAAGGGTAACAGGCATATTTGATCTTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 51.50% | 21.90% | 0.85% | 25.71% | NA |
| All Indica | 2759 | 66.00% | 5.70% | 0.98% | 27.33% | NA |
| All Japonica | 1512 | 28.80% | 56.00% | 0.13% | 15.08% | NA |
| Aus | 269 | 43.10% | 2.60% | 2.60% | 51.67% | NA |
| Indica I | 595 | 82.90% | 13.40% | 0.00% | 3.70% | NA |
| Indica II | 465 | 47.50% | 5.40% | 2.80% | 44.30% | NA |
| Indica III | 913 | 65.20% | 1.00% | 0.00% | 33.84% | NA |
| Indica Intermediate | 786 | 65.30% | 5.30% | 1.78% | 27.61% | NA |
| Temperate Japonica | 767 | 4.40% | 91.30% | 0.00% | 4.30% | NA |
| Tropical Japonica | 504 | 54.40% | 13.30% | 0.20% | 32.14% | NA |
| Japonica Intermediate | 241 | 53.10% | 32.80% | 0.41% | 13.69% | NA |
| VI/Aromatic | 96 | 14.60% | 3.10% | 2.08% | 80.21% | NA |
| Intermediate | 90 | 51.10% | 27.80% | 2.22% | 18.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0809707295 | A -> G | LOC_Os08g15940.1 | upstream_gene_variant ; 1076.0bp to feature; MODIFIER | silent_mutation | Average:29.843; most accessible tissue: Zhenshan97 flag leaf, score: 57.42 | N | N | N | N |
| vg0809707295 | A -> G | LOC_Os08g15950.1 | upstream_gene_variant ; 5.0bp to feature; MODIFIER | silent_mutation | Average:29.843; most accessible tissue: Zhenshan97 flag leaf, score: 57.42 | N | N | N | N |
| vg0809707295 | A -> G | LOC_Os08g15960.1 | upstream_gene_variant ; 3658.0bp to feature; MODIFIER | silent_mutation | Average:29.843; most accessible tissue: Zhenshan97 flag leaf, score: 57.42 | N | N | N | N |
| vg0809707295 | A -> G | LOC_Os08g15930.1 | downstream_gene_variant ; 3156.0bp to feature; MODIFIER | silent_mutation | Average:29.843; most accessible tissue: Zhenshan97 flag leaf, score: 57.42 | N | N | N | N |
| vg0809707295 | A -> G | LOC_Os08g15940-LOC_Os08g15950 | intergenic_region ; MODIFIER | silent_mutation | Average:29.843; most accessible tissue: Zhenshan97 flag leaf, score: 57.42 | N | N | N | N |
| vg0809707295 | A -> DEL | N | N | silent_mutation | Average:29.843; most accessible tissue: Zhenshan97 flag leaf, score: 57.42 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0809707295 | NA | 2.88E-08 | mr1194_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0809707295 | NA | 3.96E-07 | mr1246_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0809707295 | NA | 7.79E-06 | mr1263_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0809707295 | NA | 5.84E-06 | mr1295_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0809707295 | NA | 8.43E-06 | mr1404_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0809707295 | NA | 1.46E-07 | mr1482_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0809707295 | NA | 3.46E-06 | mr1482_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0809707295 | NA | 7.64E-08 | mr1521_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0809707295 | NA | 5.04E-10 | mr1580_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0809707295 | NA | 2.71E-07 | mr1629_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0809707295 | NA | 1.93E-06 | mr1844_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0809707295 | 2.38E-06 | NA | mr1866_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |