Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0809703428:

Variant ID: vg0809703428 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 9703428
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.76, T: 0.24, others allele: 0.00, population size: 55. )

Flanking Sequence (100 bp) in Reference Genome:

GGTCGAACTCGCGAAAAACTAGGGTTTTCTGTCTTGACTGTTAAGCTTATAAGCAGAAGCCCACTCCTTCAAAATCCCTTTTCTCCGGCTAAGTCCTTCA[C/T]
GAGCCTTCTTGCAAAAAAAAAAAAAAAACCTACATCTTCGGCGATCCAATCTTTCGGCGGCAAGCTCTCCTGCTTTTTCTTAAGCCTGGAGCAATGGCGA

Reverse complement sequence

TCGCCATTGCTCCAGGCTTAAGAAAAAGCAGGAGAGCTTGCCGCCGAAAGATTGGATCGCCGAAGATGTAGGTTTTTTTTTTTTTTTTGCAAGAAGGCTC[G/A]
TGAAGGACTTAGCCGGAGAAAAGGGATTTTGAAGGAGTGGGCTTCTGCTTATAAGCTTAACAGTCAAGACAGAAAACCCTAGTTTTTCGCGAGTTCGACC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	54.30%	35.60%	0.34%	9.80%	NA
All Indica	2759	40.60%	53.40%	0.51%	5.44%	NA
All Japonica	1512	83.00%	2.20%	0.07%	14.75%	NA
Aus	269	46.10%	52.00%	0.00%	1.86%	NA
Indica I	595	52.80%	46.90%	0.34%	0.00%	NA
Indica II	465	19.10%	68.20%	0.65%	12.04%	NA
Indica III	913	46.30%	46.40%	0.33%	6.90%	NA
Indica Intermediate	786	37.50%	57.80%	0.76%	3.94%	NA
Temperate Japonica	767	93.90%	2.00%	0.00%	4.17%	NA
Tropical Japonica	504	66.70%	1.80%	0.00%	31.55%	NA
Japonica Intermediate	241	82.60%	3.70%	0.41%	13.28%	NA
VI/Aromatic	96	13.50%	8.30%	1.04%	77.08%	NA
Intermediate	90	56.70%	31.10%	0.00%	12.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0809703428	C -> T	LOC_Os08g15930.1	upstream_gene_variant ; 94.0bp to feature; MODIFIER	silent_mutation	Average:46.335; most accessible tissue: Minghui63 flag leaf, score: 72.472	N	N	N	N
vg0809703428	C -> T	LOC_Os08g15950.1	upstream_gene_variant ; 3872.0bp to feature; MODIFIER	silent_mutation	Average:46.335; most accessible tissue: Minghui63 flag leaf, score: 72.472	N	N	N	N
vg0809703428	C -> T	LOC_Os08g15940.1	downstream_gene_variant ; 1371.0bp to feature; MODIFIER	silent_mutation	Average:46.335; most accessible tissue: Minghui63 flag leaf, score: 72.472	N	N	N	N
vg0809703428	C -> T	LOC_Os08g15920-LOC_Os08g15930	intergenic_region ; MODIFIER	silent_mutation	Average:46.335; most accessible tissue: Minghui63 flag leaf, score: 72.472	N	N	N	N
vg0809703428	C -> DEL	N	N	silent_mutation	Average:46.335; most accessible tissue: Minghui63 flag leaf, score: 72.472	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0809703428	4.71E-06	4.71E-06	mr1067_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809703428	NA	6.17E-06	mr1109_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809703428	5.80E-07	2.74E-08	mr1402_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809703428	NA	7.15E-06	mr1619_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809703428	NA	1.44E-06	mr1795_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809703428	NA	1.11E-06	mr1962_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251