Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0809699938:

Variant ID: vg0809699938 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 9699938
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.84, A: 0.16, others allele: 0.00, population size: 55. )

Flanking Sequence (100 bp) in Reference Genome:

ACCACCGCAGATTGGGTCGAGGGGGGTAATTCGTTCGGTTTGCATAGTTGGGGGTGAGGAATGTCCGGTTTTGTGGTTTAGGGGGGTAATTCGGACGACC[G/A]
TGATAGTTCGGGGGGAGGGGGTAATTCATACTTTTTCCTTATTTTTAAGATATATTTGCATCATTGTACTCTACATAAAATATGTGACAAAACAAGATCC

Reverse complement sequence

GGATCTTGTTTTGTCACATATTTTATGTAGAGTACAATGATGCAAATATATCTTAAAAATAAGGAAAAAGTATGAATTACCCCCTCCCCCCGAACTATCA[C/T]
GGTCGTCCGAATTACCCCCCTAAACCACAAAACCGGACATTCCTCACCCCCAACTATGCAAACCGAACGAATTACCCCCCTCGACCCAATCTGCGGTGGT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	42.30%	40.70%	0.34%	16.59%	NA
All Indica	2759	65.60%	22.10%	0.47%	11.78%	NA
All Japonica	1512	2.30%	82.60%	0.00%	15.08%	NA
Aus	269	42.80%	3.70%	0.00%	53.53%	NA
Indica I	595	82.70%	17.10%	0.17%	0.00%	NA
Indica II	465	47.10%	14.80%	0.65%	37.42%	NA
Indica III	913	64.40%	27.80%	0.44%	7.34%	NA
Indica Intermediate	786	65.00%	23.70%	0.64%	10.69%	NA
Temperate Japonica	767	2.00%	93.90%	0.00%	4.17%	NA
Tropical Japonica	504	2.20%	65.90%	0.00%	31.94%	NA
Japonica Intermediate	241	3.70%	81.70%	0.00%	14.52%	NA
VI/Aromatic	96	11.50%	10.40%	1.04%	77.08%	NA
Intermediate	90	33.30%	50.00%	2.22%	14.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0809699938	G -> A	LOC_Os08g15930.1	upstream_gene_variant ; 3584.0bp to feature; MODIFIER	silent_mutation	Average:24.028; most accessible tissue: Zhenshan97 flag leaf, score: 47.303	N	N	N	N
vg0809699938	G -> A	LOC_Os08g15920.1	downstream_gene_variant ; 2648.0bp to feature; MODIFIER	silent_mutation	Average:24.028; most accessible tissue: Zhenshan97 flag leaf, score: 47.303	N	N	N	N
vg0809699938	G -> A	LOC_Os08g15940.1	downstream_gene_variant ; 4861.0bp to feature; MODIFIER	silent_mutation	Average:24.028; most accessible tissue: Zhenshan97 flag leaf, score: 47.303	N	N	N	N
vg0809699938	G -> A	LOC_Os08g15920-LOC_Os08g15930	intergenic_region ; MODIFIER	silent_mutation	Average:24.028; most accessible tissue: Zhenshan97 flag leaf, score: 47.303	N	N	N	N
vg0809699938	G -> DEL	N	N	silent_mutation	Average:24.028; most accessible tissue: Zhenshan97 flag leaf, score: 47.303	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0809699938	NA	7.63E-06	mr1202	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809699938	NA	3.66E-07	mr1510	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809699938	NA	5.69E-06	mr1918	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809699938	NA	9.94E-11	mr1600_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809699938	NA	9.12E-06	mr1600_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809699938	1.52E-06	1.03E-07	mr1607_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251